GenePrediction:GLEAN_3520 Details

Name: GLEAN_3520
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:632949..636051 (+ strand)
Length: 3103
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:632949..633746 (+ strand)
Length: 798
Type: CDS
Source: GLEAN
Position: GCSC_156:633811..636051 (+ strand)
Length: 2241
>GLEAN_3520 class=GenePrediction position=GCSC_156:632949..636051 (+ strand)
ATGTCCCGTTTGCAGGCGGCCACCTACTCTGCCGTGGCCAATGGCGGGTCCGGCCGGCCTCGAGGACGGATGACTGGCAA
AGCCGGCGACTTTGCAGAGAGCCACCAGGCACAGAGCACCGGCATCAAGCGGTGGGATGGCAAGGCCAGGACCAGCCAAG
ACTGGGACTGTCTTCGCCAGGACCCGGATCTCTGGTTCCGCAACGGCAACTGCCATGTGCACCTGTACGGGAAAGGTCAG
TCGCGGCGAGGCCCTGTTTTCAAGGTGCCCTTTTCGACGCTGCTGGCGGCCCAGTGCCACCCGCTGGTCGAGCGGTTCAT
CGCCCCCGACGTGCCGACGGTGCCCGAGGCCAGCGAGGCGTCTGACTGCGGCAACGACAGGCGGGCGTCGCTCGCCACGC
TCGACTACTGGGCCCGTATCCGGCGCGTCGGCCGCGTCGACCTCTACATCCCGCCGCCCGTGGGCGCAGACCTGGACCAG
ATTCTGAGCCACCACGTGGCCATGCGCAATCTTTTTGCCTGGATATTCCGGCGGCCGCTGGTGGGCGAGCATCTTGGGCC
AGTGTTGACGTCGCTGCTCGATGCTATGCGCGACTTTCGGTCAGCCGACAGCGACAACGTGCACGATCTGCTGGTGTACA
TCGACGAGGCCGGCTATCTTCAGCTGACGGGCCAGCCGGACTACGCGATGGGCGTGTTGCAGCTGGCCGAAGCAACGCAG
AACCGGGTGCTGTACATCGATGCGTTTTCGCACTGTGTCGGCATGTACAACCGCCTGTATCTCAGGTCAGAATACTCGGT
AAGCAGGAGACAGCCCGATGCGCCCGGTGTGCTGAACTAACGAGGCCGCTCACTCTCTCTAGCACATTAGCCCGACGTCC
CGACGGCTGATCCGACGGGCTCGACTGGAGATGGACATGCGGCTCGGTGCAGCCGGAAAGATGCTGAAGAACTTTCTGGA
CGAGGAGCTCTCGGAGACATACCTGGGCCTCACGACGGCAGCCCGCGCCCATCTGGATCGATTCCGGACGTATATTCTGG
GTTACTACACGACTCGGCTCGGCTACTACCCGCCGTCGTCGATGGATGTGCGCAGCACCATTTTTGAGCCACACATTCTC
CGGTCTCTGACAGGCGACTTCCAGGCGCTGTACGACTACCTGGTGGACGAGGAGTACACGATTGCGTCGGACAGTCCGAC
GTTGGCACACGGTGGCGTCTGCGTGCTGCAGAGCGTCGAGTCGTTTGACGAGCGCCACAAGTTTCCGACAAGGGCACATC
CGCTGCCACTGCTGCCACAGATTCCGTCAGCAGCGATGGCAAGCGGCAATGGCAGCGGAATGGGAGGCGGAGCCAATGGA
AACGTTATCGGACGGCGCAACCGGATGGCCTGGTTTAGCGGCAGGACGATCGACAAGCTGATGCAGAGCCGGTCGGAGAA
GCTGCGGCCGAGCAAGCGGCTGCTGGCACACGCGGCGCTGTTGAGGGCGACGACACAGACGGAACGGCCGGAGCTGTCGC
AGAACGAGCTCGTGTGGGCGTACCGGCGGTTCGAAGAGGAGTCGGTACTGTCGCCCGTGAAGGCGGACCGCGGCGAGAAG
ATCTCGATGGTGGACGCGCGCAAGGTGCGGTGGATTTTCATCTACGCGGTGCACCAGGCACTGCAGAACCACTACCTGCC
GCCACCGGCGGAAGTGCGCGATGCCGGCGATGTGCCGTACCATATCAGCATCTCGACGGCGAACCTGCCGCCGTGGCAGG
ACAGCGATGCGGGCAAGAAGGCAGCTTCACCGGTCTCGCGCCGGCTGACGATCATGTCGACTTGGCCGCATTTAGCCGAC
GGAGCCGACATGGAAGACGGGAGCAGCAGCGATCGGTTTGGTCCATCGACCTTGCTTCCCTCAACGCCGGGAGTGTCGAC
GCCCGGAATGACGGACGAAGAGGAACAGCGGCCACCGACGCCCGAGTTCTCGTTTGATATCCGGCCCGACATCGACTACC
TCGGCCTGGCCAACCGGCACGAGACGGGCGGCTGGACGGAGAATAGCTCGCATGCGTCGAGCAGCAGCTACCAGCACCAG
GTGGAAGTGTTACCGCGCACGCGCAGCTTGACGAGCAACCTGTCGCGAAACGCGGCCATCCGACGGTCGCTTGTCCTCTT
CCGCAGCAACAGCACGCGTCCGCGAAGTGGGATCATGGTGGTGGACGAGCAGAAAGGCGCCGGCGACAACTCGATATGGC
CAGAGTCTGAGCAGCAGCAGCAGCGACAGGTGCGGCCAATCTCGCGGAGTCACGCCCGATCGCCATATCACGAGATCCTC
GTGCACGGCTATGGCAACGGCACGAACCCGGTGTGCATCACGCCGTATTCGTCTGTTGACGGCCGTCAGAGTGGTGGCAG
CGACGGTGTGGTCTCGCCGACAACGGCACGCACCCTGTCGACAGCATCGACTAACTCGACCAACTCGAACGCGTCGGACT
CGTCGGCCGAGAGCGCCAAGAGCGTCGAGAGCGCGGCGACGACGATATCGAACAACAGCGGCAAGAGCAGCTTCCGTCAG
CGTGCGCCACCACCACTGACGCTGCCTGTAGCCAAGAGTCGGCCCAGTACGGCGACGCCGTCCCCTCGGGCAACTGGCTT
TCGCAGCGTGTCGTCACCGCTGACGCCAAGGGCGCCCATGTCGACGACACGATCACCGGTTGCCGCTCGCAGCAGCGCCC
GTCCATCGCATCGTCGTTTCAGCGTCTACGGCGGTGGAGACGAGTATGCGATGATGCGGACGCGCCGCAATAGCGATGCC
AGCCTCCGGGCATCGCGTCGGAGCAGCACCATGGTTCCGGCCGTGCCCAAGATGCCGTCGCTGCGGCAATACCGGGTGCT
CTGGAACGAGCGGCCACACTCGTCGCAGGAGATGCTGCTGGCCATCCGCGAGAGCCGCGAAAGCCTGCAGACGGGCTATG
CGGTCGTGCCGGCAGCACCGACATCGCCAAAGCTGCCGGGACCATCGGCACCTCCCTCCAGAGCTGTGAACAGTGCCGGC
GACGTGCAGCCGGAGTGGGAAAAGTTCTCCGCCGGATTGGGTGGACACACGGTGCTTCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62