GenePrediction:GLEAN_3522 Details

Name: GLEAN_3522
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:640972..644207 (+ strand)
Length: 3236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:640972..641415 (+ strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_156:641494..641513 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_156:641584..641688 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_156:641754..642016 (+ strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_156:642103..642337 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:642398..643710 (+ strand)
Length: 1313
Type: CDS
Source: GLEAN
Position: GCSC_156:643786..644207 (+ strand)
Length: 422
>GLEAN_3522 class=GenePrediction position=GCSC_156:640972..644207 (+ strand)
ATGGAGCTGACTGACCGCACAGACACCCAATCTGGCAGTGCTGCCGGCCATTCTTCAGAAACTTCGGCCCACGAGCTCGA
GGGCCCAATCTTCGGAATGCCTCCACTGGGAGCCAAAATTGACCGAATCAAGAAGCACGTCTCACGCTGGAAAAAAACGA
GAGACAACACGCCAAGCTCGCTTGCTGCTCCGGCTGTCACTGTCTCTGCATCTAGCTATGTCGTCTCTGCGCCCCTCGGC
CCCCTTGGGTACCCCCGCATCGGCCCCGATAGCCCACTTCCTTCGGCTTCCCCGCTGCAGCCCGTACTTACGTCGCCAAC
CAGCACGCTCAGTCATGGCCACAGCAGCAGCAGCAGCATTGCCAACAACAAGCTTGGCTTAGGCTACAATGGCAACTCGA
TGAACTGGCAGCCGGCACCGCCTGCACCAACAGTTTCCATTAACGTGACCCCGGCTTGCCTGTCAGTTTCCTGAGTTGCA
CTGTTCCCTTTTGCAGCCGAACCTGGCTACTAACAAACCCAGTCCAAGTTATGGTTGCAACGGTATGCATCTATCCTGCG
GATGTAAAATGCCCTTTAGCGACCTTTGTCGTGAGAAATTCTCCTTTACCAGCCATGCGCAGTTACTAAGGGATTCAGAG
GATCCAAATTTCGAATCCGGCGTAAATGGGAACCCTAGTCACAACCTGTTGCCTCGCTTCAGCAACGGCCAGCAATGGTA
TGCATCCAGACAGCCACCATGTCAAGGTGTTTGCTTTATTTCCACCAGACTAAAACTCCCAGCTATTCCGTACGTCAAAT
CCCAAAGATTGATGAGTGGTGGACGAATGCTTTGCGGGATACTGGCAAGGATGTCTTTCGCGATATCGCAAGGGCTCTCC
ACCCTTCGCCTCCGCAGTCTCCCAACCTCTCGGTGTCTAGTAATCGGGCAATGAGCACGATCGCTCGCCAGCTTTCCCAG
TTTTCCTGCAGTCATTGCAACTTCAATTTCAACCTCAAGGCGAAAGATGTAATCTCCACCATGCAAACAATGATTGCCAA
CTATGGTATGTTGATCTGGTCTGGGATCCTGAACCTTCCCGTGTCTGATGCATCCGCTGCACCTAATGGCTGAGATCTCT
GACAATAACAGCCCGAGTAGGACGTGTCACTTCTGGCTATGAATGCCCGCAGTGCAAGGTCCTAAACTGTATTGGATGCG
GTTTGGCTGCCCCGTCTGCTTACGACAGCACCGGAACCGATAGCCGGCCGATCATATCCTTGTGCTGCGGGGTGGGTCGC
ATGATGCTCATCTGGGCTCTTTGCTGCGGCGTTGATTACAATGAAGTCACACCTGCTCCAGCTGTCGTGCAGGCCGAGTC
TGGAAGGTATCCCTTCCACCTTTTTCGGGCTTCCAAAAAGCAAAAAGGTCACGCTGCCCATGCCAGCCTGGACTCCGCTG
GCACTGGGTCCTCTGCCAAAACCCCTCCCAGTAAATCTCACGGCAAGAGCAAATCGGTATCCAGCAAGCCAAGCCACAGC
ACAGCGGCGGCTTTCACTATCAGCAAGAAGGCATCGAAATCTGCCACTCCCAATGGAGTGGGTTATGGCGATGCATATAT
CTGGTCGCCTATGTCGAACTCGCCATCCGCGTTTGGTTCGGCACAAATACGAGCCAGCGTGATGGCGGAGGACTACAAGT
ACCAGACTTACTACCTTCTGCTCTACCGCCTTCTCCCGCGCTCAAACAAAGGCGTCCATTTGGACGACCCGTCGCCAGCG
TGTGCAACTTTGTTACGCCACATATTATGCCGAAGCCCCCTTCTTGCAAAGGCCTCTGAATATCTTCGCAACACCTCGAT
CGAGGATATCACGAAACGGCATGGACTGTACAGCGCCTTGTGGCAGTTTCTGGATGCCATCTGTGACCAGCCGTCCTTGG
CCGTTGTTGTGACGCAGCCTAGAACCTTGTTTTCTGAGGCGGAGCAGCTTCCTCATGCTTGCTTCCCGGTACTAGAGGCG
ACCACCACGATGTCAGCATCGACAGAGAGCGGAAAGGACAAGGAGAAAGAGCGGGAGTCGAGTGAACCCTTGGCCGTTCT
CCTCCATCGCATCGCCGAACTGTGTCGATTTGTCCTCCAGCAGTCTACCTACCACAGCTCCGAGTATCTGACGGGCGACG
GTATTAAGACGTTGGGTATCTGCCGTGAGTTGGCGGCTCTGAGTGACCGCTACTCAGCTGTGGAGTCACAGTATCTGCAA
AATCCTCAATCTTCTGTAGGGGGGAATGCACAGCAGACCGCCGGCGAACAGAGAAGGCCGACCAGGACGTCAAGCCGCAC
ACGAAAGGCCAACGAGCTGGCAGAAGAGAAGAGGCGTGCTGAGCAGATGACGGCATGGCACCGGGAACACTGCTTGTCCG
ATACGGAGGATGCGAAGGTGATCGGCAACAACTACTTTGAGCCTCTGACAAAATCTATTCAAACGTCTCCCAAAGGGCGA
ATGAAACGACTGATCAATGACGTCAATATCCTGCGGTCTTCTCTGCCGGAAGGCATATATGTGCGCCACGCCTCATCACG
GTTGGATGTGATGAAGGCCATGATTGTCGGCCCAAGAGGGACGCCGTACGAAAACGGATTGTTCGAGTTCGACATCTTTT
GTCCGATCAACTTTCCCCATTCGCCACCACATATGAGGCTGAAGACGACCGGCCAGGGACAGGTTCGGTTCAACCCAAAC
CTTTACCATGATGGGACGGGTAGGTATTTTGCTTTAACCTACATCAACGCCGGCGCGGTGTGCTAACCTGACCCAGTCTG
TCTCTCACTGCTAGGAACTTGGGGGCAAGGGCAGACGTGGAACTCGGAGCACAGCACTCTTCTGCAGGTGCTGGTATCTA
TCCAGGCAATGATCTTCTGCGATGAGCCGTACTACAACGAGCCCGGACGGGAAGTGCGGAAAGAGCCGGCGGCCAGTGCT
CAGGAAAATGCATCGCTGCAGAAGAACACGGTGCAGCACGCTATGCTGTACTGGCTGAACTTGCTGTCTCTCGACAAGGA
GAACGGCAGAAACGGCACAGCGACCATCTCGAGCTCGCTGGCGTTTCCGGACATGGCGGTGTGGGAAGACGTGGTGCGCA
AGCACTTTGAGCTCAACGGACATGCGATCATACAGGCGGCGTCGGGTTGGAACTTGCAGGACGGGAAACTTCAGGAGCTT
ACGACAGCGTTGAGACGGCACTCCTTTCTAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62