GenePrediction:GLEAN_3524 Details

Name: GLEAN_3524
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:652117..653848 (+ strand)
Length: 1732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:652117..652236 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_156:652308..652385 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_156:652453..653301 (+ strand)
Length: 849
Type: CDS
Source: GLEAN
Position: GCSC_156:653351..653848 (+ strand)
Length: 498
>GLEAN_3524 class=GenePrediction position=GCSC_156:652117..653848 (+ strand)
ATGCTGACGTTGCCGGCGGCAGCCGCCGTGGCCGTGGTAGCCCTAGCGATGCCGGCAGCCGCTCACGACCACCAGGCGAA
CGTGATACCAGAGGGACAGACGACGACGCAAGAGCCGATTGTAGGTGGCAGCCAGCAGGAGGCAGCTGAGGACGTTTGTC
TGTTTCTGTGGCCGTGCTGATAGAGGGACAGGATGCGACGCTGTGGGTGCATATCCTGCTGATGACATTTGTCTGGGGGA
TCATGTTTCCGGTCGGCATGGTTTTAGGGGTATGTTTTTTTTTTTTTTGCCTCGCTTCGCTCGTTTGTTCGCTTGTTCGC
TTGTTGACGTTTGCAGATCATCAAGAGCCGCTGGCACGTGCCGCTGCAGGTGTTCAACACGGCCCTGGCCGTGCTCGGCT
GGGTGCTGGGGCACATGCACAAGGGGCGGCAGTTTGTGGGCAACAACGTGCACGGCAAGTTTACGACGACGCTGGCGCTG
CTGCTGGCGGTGCAGATAGTGGTAGGCGTGTATCTGCGGCTGCACCTGGAGCGGGGTCTGCACGGGCGTCTGATCCGGCC
GGCGGCGAAGCTGGTGCACGGCGTCGTCGGCAAAGCCTTTCCGGTCGTGGCCTGGGTGCAGATGGTCTTTGGCTTCATCA
CGGCGCTGGGCTTCTGCCAGGGCGACCACGTGGGCCAGTGCGCGGCACACTTTATCATGGGCGGTGCCTTTGTGGCGTAC
GGCATCCTGCTGACGCTCCTGCTGGTCGTCGGCCAGGTCTGGCTGCGCCGTTCCGGCCGCTCGCCCGAATTCTTTGACAG
CGCCGTGATCGCGGCCTGGGGCTGCGTCAACACCTTTACGGAGCACCACTGGGGCACCGCCTGGGTCAAGAACGACTGGC
AGCACACCACGATGGGCATCATCTGGTGGAGCGCCGGGCTCGCCGGCATCTGGCTCAGCCGCACCCGCGACGGCCGTCCC
CAACGCAACTTCGTGCCCGGCTTCGTCCTCTTCCTCACCGGTTGGGCCATGTCGTCCCACCCGCAGGAGCTCATGATCAG
CGCCGCCACCCACGCCATGTTTGGCTACTCGCTCATGGCCTGCGGCGTCACCCGCATCATCGAGGTCGCGTTCCTGCTGC
GCGACCGCAACAGCATTTCGGCCGACGGCATCGAGATCAACAGCTTCCAATACATATCCGTCTTTGTACGTACTTCCTCT
TTCTTTCCTATTTAACCATGTGCTCATACTACAGCTCCTCTACGCTTCCGGCTTCCTCTTTATGGGCGCCACCGAGGAAC
AGATGCTGCTCGTGTCGACGTCCGGCCTCGACCACGTCGCCTACATCCTGATCCTCTACAGCGTCGCCTTTCTGCTCTTC
CTCTTCGTCCACCTGCTCATCTCCCTATACGACCGCACCGTCAACGCCGACCTGTTGGCCGCTAAGCAGCGCCAGTACCG
TGCCGAGCTGGAGGCCGCCGACAACGACATCTCTGCCGTCGGTGCTGTTTCCGGCACTGCTGCCGGCACCATCCGCATCA
ACGGCAACAGTCGCGGCCCGGCCGATAGTCGGCAGGTGCGTGACGCCGAGGAGTTTGAGCTGGGCGACCTGGAGAGTGAA
GAGGAGGACGACGCCCTTTTGGCAAACGAAGACGAGGAACAGTCGTCCCGGCGGAAACTGCTCAAGCAGGAGAGCGACGA
CGATGTCACGCTGGTCCAGCCCAACGGCCATGCCACCAACGGACATGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62