GenePrediction:GLEAN_3526 Details

Name: GLEAN_3526
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:656089..657988 (+ strand)
Length: 1900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:656089..656148 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_156:656473..656583 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_156:656798..657127 (+ strand)
Length: 330
Type: CDS
Source: GLEAN
Position: GCSC_156:657186..657552 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_156:657618..657735 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_156:657795..657840 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_156:657911..657988 (+ strand)
Length: 78
>GLEAN_3526 class=GenePrediction position=GCSC_156:656089..657988 (+ strand)
ATGGAGAGCAGGGGCGTCAGTGAGTTCAAGGGCTCAGAACTGCACCAAGCACGCGTACACGTATGTGCACAAGGCAACTC
TAGCCCACCTCTGCCCTTTTTTTTCCTGCTCCTCGTGCGTTGGCACGTTAATCCAGTGACCGCTCCCCTCACCGCATTCT
CATAAGCAGCTTGGTGGTCGCATTTTCTGCCTGGTCAAGTGCGAGAAAGCGCAAAATAAGGAAAGAAAGAGGGAAAAAGG
GAAAAAGGGAAAAAGGGAAAAAGGAAAACAAGGGAAAAAAAGAAAAATGGCAGAAGCAACAGGCGATAGGCAGAAACTAG
GAACGGATGGCGGATAGACAGAAAAAGAAAAGAGGGAAGAAGCAATAAGATGAAAATGAAACAGAACCCCGGCACGCACT
CGTACCTCGTCCGGGATGCGGTAGCCTGTGCCTCAAATCCTTGTTGCCGGCCCGGCACTGTGGTTCTCCTCGGGCTATTC
CTTGTCACTTACATGGTACGTTTGCATGGAGCTTGGGCTCCCATGCTCGCTGAAATATTATGTACGGGTTGTATGACAGC
TATAAGCTCGCCTGCCGTCCTTGCTGCTCGTTCCGTTGCTTGCTGCTCTTTGAGTCGTCTGGCAAATATCTGCTTTCTGC
TTGCCCCGGGTCTCGAGATGCTTCTTGTCTGGCCAATCCTACGCGACATAGTGCTGTATTGCGCCCCAGTATGCTTTCAA
GTCGCCCGTCAATAGCGACAACCACCATCGTTCTCCAGTTCTCCAGCCTTCCGACCCGAGCTTTCAACTCCAGCTTCGCC
CTTATCGCCCTCGCCTCTGGTGGTACATACACACCACCTGGCGGGCTCTATCACTCCGCTCCGTTATGTCGTCCGGTGCT
GCCTCGACCGACACCAGCAGCAGTCGGGGCGCCTATGTCCACAAAGCAATCTGGGTGCTGGCAGCCTTGGCTACCACCTT
CTTGGGCCTTCGCATCTATTGCAAGTTCCGCCGCCGACGAGGCTTGTGGTGGGACGACTATTTCTTGCTTCTGTCGTGGG
TGGGTGATTCGCCAGCTTCCTTCCTTCCCCACTGTTGCGGTCCTGACGGTTCTGTAGATACTGCTCCTGGTGGGTGCCAT
AACCACTACCATAGCGGCACACAACGGCTTCGGCCACCACCATGATACAATCGGCTCGGAAACCTCCAAGCTGTTACGCA
TCCTCGGCCTGGTCTCCGTCTTCTCTTCCTTCACCTCGGCCGTGGCAAGCAAGACCTCCTTCGCCGTCACCCTCATCCGC
CTCTCAGACGGGTGGCTTAGGCGTCTTGAGTGGGCCATCGTCATCTCGTTGAATTTGCTTCTGCCACTCTGCGCCTATTG
CATCTTCGGCTTCTGCACTCCGACTGCCAAAATCTGGAAGCCATACATCGAAGGCAAATGCAGGTCCATGCATGTGGCAG
TCGTCATCGGTATCGTCTTTGGCTGTGCGTTGATGATGCCAATCCATTCACCCTTCTCTATTTCAGACCTGTTTCTGACT
CTATGACAGCGTACATGGCCTTTTGCGATATTGTGCTCGCGCTGCTCCCGTGGGGAATCTTGATGCGCTTTCGGATGTAC
CGCCGAGAGAAAATCAGCATTGCAATAGCAATGAGCATGGGAGTCTTGTGAGTCCCATTTGCATCTCGAATCGGAATATG
CCAAATGCTAACATGCTCTTTCCCAGTGCCTGTGCCACTGCCGTCGTCATGTGCACCAAAATGCCTCTTTTGGTGAGCTC
CGACTTTACGTGTAAGCCCATCTTTCGCTGTGATGCATTTGTTCCAAGCTGACACTGTGCAGTTGAAGGTGTGCCCCTTG
TCATCTGGGGCTTCGCCGCGAGTGCCGTATCCATTATGGCTGCCTCTGTACCTGCCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62