GenePrediction:GLEAN_3527 Details

Name: GLEAN_3527
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:663959..669420 (+ strand)
Length: 5462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:663959..664563 (+ strand)
Length: 605
Type: CDS
Source: GLEAN
Position: GCSC_156:664617..665615 (+ strand)
Length: 999
Type: CDS
Source: GLEAN
Position: GCSC_156:667308..667557 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_156:667641..668100 (+ strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_156:668249..669420 (+ strand)
Length: 1172
>GLEAN_3527 class=GenePrediction position=GCSC_156:663959..669420 (+ strand)
ATGGTATACTTTTACTTTGGATTCGACGATTTCATGTGCCAGAATCTCTCAACGTTCCTAAAATCAGCGTTGGAACAGCT
TTGTTATCGAGAGAAAGTACTCGCACTGGTTGAGGCCTTGCACCAGCAGTATTGCCCCGGGCCACCATCACTGCAAGCGC
TAAAGACTCGATTTTTTACGGCAATCGAGCTTCTCTGCGCCGGAGAAGAAGAACCAGACTCCACAGACTCTACAGTCTCT
ATAGGCTCTACAGAGCCTCTTGAAGAGACTGTAGTGTCTGGTGCCACCTACCTCGTCTTGGACGGCATTGATGAAATACC
GTATGGTCCTGAATGTGAAATGGTTATCCAGTTCCTCAGCCAATTGGCTGCTCACCAGCACCGTCGACTACATATTCTCG
TATTCAGCAGGCCTGAATGGGATATCGAAACAAGCGTTGTACTCAGCTCCTCTTGGACGGCTTTGAGAATTACTTCTGCA
GACATCGAACCTGACGTGAAAACCTACGTCGTAAATCAGATTGGACTTAATCATAAGCTAAGAAAGCAGCCTGAACATGT
CAAGGACGACATCGTCAAAAAGTTGGTGTATGGTTCTGGTGGAATGTAAGGCAAAGCTCCTTTTACCAAAGGTCGAACAG
TATTAACTTGTCTTATAGGTTCCGGTGGACCGCACTCCAAATGCAGGAGTTGAATTCGAGACGAATTATGCGCAGAAAGG
AAAGTACGTCCATCCTATCATCTCTCCCGATTGATCTGGATTCTACATACGAACGAATACTGGCCAAGGTTGATTCAAAC
TTTGTGGATGAAGCTGCTGCCGCACTTCGGTGGCTTGTCTCTGCAAGTCGCCCTCTATTTGTGGAAGAGCTGGCTGAAGC
CTGCATCATCCGGGTTGAGGACCCCTGTCCGTTTGACCGTGAGAATCGACTTAGTCCGTTGGACATTCTCGATCTTCTCC
CTGGCCTCATCAAAGTAGAGCCAGCACCTGATCCATCCATAGACCTACGGCTCCGATTTCACACAGTCAGCCTAGCACAT
TTCTCAGTGAAGGAGTACCTTCTCGGTCAGCGCATCTGTTCAGGTCCTTTGAAAATATTCGGCGTCGATGCAAAGCTGGC
TCACAGCTACATAGCCCGCTGCTGTCTGGCCTACATTTCGTGCTGCAATGACGTTGTGTTGTCGCTTAAGATTGATGATC
CGGCTGATTCACTGAGACCATACGCCTTTTCAGAGTGGACACATCATGCATCAATGACACCACAGGATCTTCTCCGTGAC
GTTTCGGCTCAGGCATTGGAAGTCTTTCGAAATCCGGAGACATGTCTCACCATGAACGCCATCACCAACCTAGTTCAGCG
GACAAAAAGTGGCGGCTTCAGATCACAGCTCTCCATTCCTTTCAATTCGTACAAGACAACAGACTGGCCGCGATATTACA
TGCTGCTGTATGCTATCAGGCTGCAGAATTTAACCATGGTGAAGCTTCTTCTCGAGCAGGGCCTGGACCTCAGCAGCAAT
GCTAGAACCGACGACTTTCTTGTACTGGCCTTAGATTCACAACAACTTGATATTGCCGAGTTACTTCTGGACAATGGCTA
CGAGCCGGGAAGATCCGAGCTGCTCCTGGGAATGACACACGCAACACCTCACATTTTGTCTATTATTTTAAATCATGAAC
CACCTCTGAGCCTACATGACATTCTGAGAGCGCTCTACCTTGCAGTTGAGAGTTCTCACGATCAGCAAGCCGATTTGCTG
TTTGAGCATACAATGCCAAAATGTGTTAAAAATTACCGTAAACAGTCTGGCTCAAACAGGCAGCTCACAGGCTGGTTCAG
TAGCCTCTTTGAAGTTTCTAGTGACTTTGATTCTCCTGCCTTGGCAAGATTCTTACGAAGCCGGGTTTCGGCCAAGATGC
GCAAACCGATAGACGCCAGGAACACGTTTCTGGAGGCATCAATACAATCTAGGAACAGGAAAGCAGTGCCGAGCTTGCAA
TTCAAAATTGGTACGAATCATTCGCCCTCGTACAGTCGAGCAGAAGGCACGTTCTTAACCTAAGAGCCACAATTTCACAA
CGCCTATTATATTTGGGACTTCTGCAGAAGGTCCCCATGCAGGCAGTCTGCCAACCCCGAACATGCTCCGTAAGATTGAG
CACAGTACATGGCAGCCGACTGCAGGACACCGTGATACAAAGCTACGTGTTTTCTTTCGAATTTCGACTAAAGAGCTCAA
AAATAGATTAAGCCAGTGTCGTTTCTTGTCTACGCGTGAAAGCGATCTCAGCTTGTTAGCCACTTAGTCGATAGGACGGC
CGAGTTTCTATTCTTACGTTAGCCTCGGAACAGTTACGAAAGTACATGTTTATGGGCATGGACGGCGTATCACATACATG
CTGATGGAATTACTGAAACGTGAATGGCCATGTCGATTTCAAGAATATGGTGCGATTCAGGTGAGCGCTATACATGCAGC
CGGTTATGATGAATTGCAGCTCAGCTAATATTGTTCATTCGCAGTATTGCTCGGGTTGCTCTTCGCTACGCTACTATGGA
CTTATGTTTTAAAGCCGCGCCTTCCGACTATTGCTTTCATGATACGCTCACATTCCACAGTCCTGTGGTTCCAGAGCTCA
TGAGAAACCCAGGATCTAGAAAAGTGGCATTAACCAACACGCCTCGTCTTTTTTGCAAGGATACCAAAGAAAGCTGCGGA
TATCAAAGTGCGTTCTTTTTGCAGAGTGTACCGAAAGTATGGAAATTCTGAGGTAATATATGGCTTTAGAAAGGGCTAGC
CGGTCGACCCAGTTCCAAGTATATTTCTATGCTTACAGCATGGGTGTATCATATAGGACGAGTGATCGATCAGACGGATG
GAGATGGAGAAGCATAGGATCCTCAAAACGTTTTATAGCTATGATTTATGTATGCTGAAACTATAAGAGACCTTGCATCG
CTTCCTGTGATAGAAGTTTAGTCTACTACCACGTGATGAAGATACTACGTTGGCGGCGGTCGGAGCTATGTCGTGAGCAC
TCGGAGACCGCCTTAGTCATCCAGTCTAATCATCACACTAACCGCATCTCCGGCGTCGGGTCAGTTTAGCGCCGGATTTG
TAGCCTGGCGGAACTAACTGAGCGCCGGGCAAGGCAAACGGGGCAAAATACTGCCAAACGCAAGCCAATGACCAGCACAA
GGATGACGTTCATCTAAAGCCCTGTGATTATAAAGGACGGTCATCCCATATGTATTTGGATCACATACAAGAGGCGCAAC
GGCCGAAGACGACGGATTCCACTTTCCGAAGACACAAGCAATACGTTCAGAGTCTAAACCAATTGTTAGGACCGCCTTTG
TCGACTTGATATTCTGGTTCCTCAACATGTCTACCACAGCTACAGATGGTGGGGCTAAGCAGCTTCCACTAGGGGCTGTA
GACGATGCGACGATGGCGACAATCACAGACGACGAGAAGGCGCTGAACGGCCGCGGCAACCCATCGGCAGACGCAGCAGC
ACCGGCTGGAAATGGACCATCAAATGTTCAGCCACCCCGATCGACGATACAGATTTTTCTGCTTATGACGGCGGCGTGTG
TAAGTTTGTTATGCAACCCTCTACTCTGTCACCGTGGCTCTGCTTTCTTGACAGCCCCCATAGTCCTCTGCTGACATCAT
AGATGTCCGTCTTCTTGGCGGCCCTCGACATGACCATCATCACGACGGCACTGCCAACGATCGCCGAGCACTTTGGCTCA
TCGGCTGGCTTCGCCTGGGTCGGCTCGGCCTTTATGTTGGCGGCGGCGGCCAGCACGGCGAACTGGGGCAAGTTCAGCGA
CGTGTGGGGCCGCAAGCCGGTGTTGCTGGCGGCGTCGGCCGTCTTCTTTCTGGGCTGCGCTCTCTGTGGTGCGGCCACGA
GCCTGGCCATGCTGATTGCCGGACGTGCCGTGCAGGGCGTCGGGGCCGGCGGGCTGCTGACGCTGGTCAACATCATCATC
GGCGACATCTTCTCGGCGCGCGAGCGCGGCAAGTACTACGGCATGATCGGGATGGTGTGGGCGACGGCGAGCGCGTTGGG
GCCGATCGTGGGTGGCGCACTGACGAACAACGTGTCGTGGCGGTGGTGTTTCTATATCAACTGTGAGTGACGATGTGTCT
GGAGTGCAGTTTGTTCCTTCCATTTTGGGGTGCTCTCGGTGCTCTTTCCTTTTTTTTTTTTTCGTATTGGCATCTACATC
TTCCGCTCCTCTACCACTTGTCCCCTTGTCCACTTCTACTCACTCCTCAGTGCCCATCTCCGGAACGGCCTTTTTCATCA
TCCTCTTCACGCTGCACCTGCCGACGCCGCACACGCCGCTGCTGGCCGGGCTGCGCTCGATCGACTGGCTCGGCAGTCTG
CTGATCACGGGCGGCACGCTGATGCTGCTGATGGGTCTGCAATACGGCGGCAACGCGTATCCATGGCGATCGGTGACGGT
GATCTGTCTGATCGTCTTTGGTGTCGTGACGCTGGTGCTGTTTGGGCTGGTCGAGCATCGGCTGGCCGTGTACCCGCTGC
TGCCGACGCACCTGTTTGCGAGCCGGTCCAACGTGGCGGTGCTGTGCGTCTGTCTGTTTCACGGGCTGGCCTTTACACAG
GCCATCTACTTCTTGCCGACTTACTTCCAGGCAGTGCTGGGCGCCACGCCGCTGCTCTCGGGCGTCTATCTGCTGCCGGT
CTGCCTGCCGGTCTCGCTGTGCGCTGCCGGCAGCGGTATCTACCTCAAGCGCACCGGCCGGTTTCGTGATCCGATCATCT
TGGGACTTTTGCTGGCCGTCTTGGGCTCAGGCCTGCTTCTGAATCTGCCACGCGGCCGCAATGTGCCCTCGACCTCGTCG
GCTTGGGCCCGCATCGTCATCTACCAGGGCATCACTGGCGCCGGCATCGGGCTCAACTTCCAGCCGCCCCTTGTCGCCCT
GCAGAGCAACGTGCCACCGCAGAACAACGCCAGTGCTACTGCGTTTTTCTCTCTCACCCGCAATATGGCCTCGGCCATTG
CTGTCGTCGCCGCCAGCGCTGCTTTTGCCAACCGCATGACTGCCCAGCGTCCTGCCATCCTCGCTGCTGCCGCCGGCAAT
GCCTCCCTCGCCGACATGCTCTCCGGCGATGCTGCCCAGGCAAACTTGCTCCTCGTCGATCGCCTTCCCCCAGACCTCCG
TTCCGTCGTCCGTGCGGCCATGTACGACGCCGTCCGTCCTGTCTGGATCCAGACGACCTGCTTCGCTGCCGCCGGCCTCA
TCGCCTGCCTCTTCATTCACGCCAAGCCGCTCCAGAGCGTCCACGAGACCGTCAACACCGGCATCGAAGGCGAAAAGGAA
CGTCGTCGCATCGCCCTCGAACAACGCGCTCACAGAAAGGCTACCCGTGGAGAGCCACAGGTCCGCGGGAATGGCCCTGC
AAAGGAAGCCGCCGAGGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62