GenePrediction:GLEAN_3529 Details

Name: GLEAN_3529
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:679065..685711 (+ strand)
Length: 6647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:679065..679658 (+ strand)
Length: 594
Type: CDS
Source: GLEAN
Position: GCSC_156:680465..680812 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_156:680930..685490 (+ strand)
Length: 4561
Type: CDS
Source: GLEAN
Position: GCSC_156:685557..685711 (+ strand)
Length: 155
>GLEAN_3529 class=GenePrediction position=GCSC_156:679065..685711 (+ strand)
ATGGACCCATCCGACTTCCGCTCGACGGTGCTGTCGCGCCAGGAGAACAGCAGCAGCAGCAGCAGCCGTCACCGCGACAT
TGAGATTCTCAACCCCGAGCAGGCCGACGTGGTCTCCTCGGCCTCGACCGCTTTGCCAGCCTCGTCCTACCCATCGCGTC
CTATCGCCAGCAATAGCCATAGCCATAGCAATAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAGTAACAGC
TCGCACCACCACCAATACAGCCACCACCAGTCGCACCCCCTGCGATCCAGCCACGCTGCCTCGCCGCCGGCCGACAGAAA
CAGCTATGCCAACGGCACGTCTCACCGGCCGCCTCCGTCAGCCTCGCCCGTCTACGAATACGCAGTGCGTCCCCGCTCGC
CGCTGCGGCCGGCCGGCCATTCCGTGTCGCTGGCGCAGCGCGAAAAGGCGTCCGGCAGCTTCTACGACCCGACGACCGAC
AGGACTACAACCGTGACAGCAGCCACGGCCAGCTCGCGTCGGCCGTCCGAAACGGGGTCTCGTCGCATCAGCGAGAAAGA
GGCTGCAGCTGCTGCAACTGCTGCAACCGTTCAGGTATGCGCTTGCTTTTTTTCTTTCTTATTCTTCCTTTCTGTCTCGT
TCTGCCCCGTCTCTCTGTATATCTTTTCTTCATTTAGCTTGTTCTTTCATTCTCTTCTCTCTACCTTTGGCCTTCTTACC
TAATCTACCTACTCTATTGCTCCTTCCCTTTTCCTCCCTCTCCTCACAGCCTCACTGTCAGCTTACCCTGCATCCCGTAC
TCGTGCATCCAAATCTATCTGCTGGTCAATTTTGCTCTCCTCCGTACCGGCGTTTCTGCCTTATCACCAGGCTACACGCA
TATCTTGGCGGCTCCCTTTTTGTCGTGCGCTTTGTGCTTTTTAATGTGGCTCTTTTTCGGCTCTACGCTTGTCGCTGGTG
CTTGGCTTGACTGGCGCGCCTGCCGTCTCCTGCATCCTGTCTCATCATCCTCTACGTTACTGGATTTTTTTTTGCCGCTC
CTGGATTCTGCCCTTATTTCCACCGTTTCCTTTTCGCTCCCTTTTCTGATCCCTTGTCTTCTTCGACTCCACCTATCCGT
CTTTTTATTTTTATTCCCTCTCTCCTTGGCCTGCCATCACCTTTAATTTTCCATCTCGGTTTCTTTTCGGCTTCCATCAT
CCGCTGCCCGTCCATTAATCTACTTCCCTTCCTACATACACCGTAATCGACCGGCCCCTTTCTTCTCACTAAACGCGTCG
TCTTTTTCTTTCGCCATCGCCTTCATCTCACCCTCGCTCTGGCTTGTCTTGGCACGTCACGATGCATCATGTGTGAACGT
GACATTTACTGACACGAGCCACTGCTTTTGTCCACCACAGCATCGCGACGCGTACCAATATCCATCGCGACCTCAATCTG
TAGGCGATCGCTCGCCCTACTACGGCACATCCCACAAATCGCCCACTGCTGCCCCCGCCTCCTCGAGAAGCCCGGTCACC
CATTCACGAAAGCTCTCTGCCTCTGGCACATTGTCGTCTGCCATATCTGACTCTGTCAGCATCTCAACCCACCCACCACT
ACAAATGGCTTCTCCATCTTTGGGCCACCGCCCGCTGTCTCTGGCTGGCTCGCCACCTCCAAATGGCACCGCCACCTCCA
TACCCTCGCTTTCTTCATTTTCCAAGGCTGAGTCCCCGGCCACAAACAAGGCAGCTGCGCCTACAAGTGTACGTTCCATC
AACGCTTTTAGCTTTGCTTCAAGTGTCACGTCTCAATTCCATCCATTCCATACATCAACCATCTCCTTCCTTATCTAATG
CTGATTGCTTTCCCCTACCATATAGACGCCCAAGCGCACTGCCGACCTAATGTCCTTCTCCAACATTCTCTCCAACGCCG
AGCCGGCGGTCGAGAAGCCACGACCCAAATCACCACCCCCCGCTGAGGACGACTCTGAACATAACAATACTGCCCGGGGC
GTTCGGGTCCTGCGCTTGGACAAGCCAGAGGACAAAAAACCACGAGGTGGCCGACGAGTGGCCAAACATCGCGTGTCCAG
TGTCAAGGACAGGGACATGGACTTGGATGCCTCGCTGGTAGACATCGCCCCAAAGGCGTCGCGGCGCTCCTCTGTGAAAG
CCAATGTCACAGAAGCACGTGTGCCAGCGAAGCGACGGGTGAATGGCCAGCAGAAGAAAGCCACCCCGTCACCCTCCGTC
ACAGCAGAGCGGGAGAAGAACATCCAGACCTTTTTGAACAAGCTGGACGATGAAATGGAAGACGTCGACACCTCCGAATT
CGACGAAGAAGAAGAGATCTGGCAAGAGCGCTTTCGGCGGCGGAAAGTGCAGATGGCCACCACCGAAGCTGAATTGCACT
GTCTTCGCCGCACCGATTTGTCCGACACCTTTGCCAAACGGCTCGAAGACCATGGTTATCTCGGCACCAAGCGTTACTAC
GAAATCTACTATGACGAGGCTTTGCAGGAGGTGCGCGAACAAGAGCTCTTTGCCGAGAAAGAACGGAAGAAGGACATGCA
ACGGAAGCGGCGGCGGGAGAAGTCGATGGCTGTCACCCTGGAGCAAAAGAAGGATGCTCTGGCCCGCGCTGCCCTCACCC
AGGACGAGAATGAGCGCCAGAAGCTGCTGCGCGAGGCCGAGCGGGCTAACAAAAAGGCCCAGCAGACGAAGCTCATTCTG
CAAAAGGGCATCAAGGGGCCCGTCAGAAATGTGACCACCATGGATCTCAACCTTGAGGGCGGCACCATGTCTACATTTGA
AAGCACCGAGCTCGACGCGGGAAAGACCAAGGCCAAGGGACGCGGCGGCTCGCGTCCGAAGAAATCCAAGGAGCAAAAGC
AGCAAGAGAAAGAGAACGCCGAAGCTGCCCAGGCCGCTCTTGATGCCGGCGAGGACTTGCCCAGCAAAGAGGAGACGTCC
AAGATCCGCATCAAGTTCAAGAAGGGCTCGAATGCTGCCGGCGCTAACGGCGCATTGGGCAAGGACGACGGAACCAGCAA
GGACGACATCCATTCGAACAAGGAAAATGCCGAGCCCAAGTCTTCCCGAGGCAAGGACAAAGACAAGGACAAGATGGCCA
TTGTCGATGCACCGAAAGATCCGCTGGAGATCAAGTTTCAGTCCAAGGGCTTCAACCAAATCTACGACCAGATCTGGCGC
GACATGGCTAGGAAGGATGTCAGCAAGACGTTCCGCATGGCCACCGACTCCTACTCCACAAAGGCTTCGAACTTGAAGAA
GACTGCTCTTCTTGCCTCAAAGGAGGCGAAGCGGTGGCAGCAGCGCACTAACAAAGGCAACAAGGACCTGCAGGCCCGCG
CCAAGCGTGTCATGCGCGATATGATGACCTTTTGGAAGCGCAATGAGCGCGAGGAGCGCGACTTGCGCAAGGCTGCCGAA
CGCCAGGAACTCGAAAATGCCCGGAAGGAGGAAGCTGACCGCGAAGCCGCTCGCCAAAAGCGGAAGCTTAACTTCCTCAT
CTCCCAGACGGAACTGTACTCTCACTTCATCGGCAAGAAGATCAAGACTGACGAAGTCGAGCGCAGCACCGATCACCCTG
ACGAAGCCGCAAAGGAGAGCGCCAAGGCGGCTGCGTCGGGAACCAGCCACGGCGCAAACCTGAGCTTGGCTGCGTCCAAC
GGTGCGGTCGGCTCCAAGGTCACCAACTTTGAAAACCTCGACTTTGACGATGAGGACGAGACCAAGCTTCATGCTGCTGC
CGTGGCTAATGCACAAAACGCCATTGCCGAGGCACAACACAAGGCTCGCCAGTTCAATAACGAGGACGAACCGGCCCCCG
CCGGTATGGATATGGATGACGAGGGCGAGATGAACTTCCAGAACCCCACCGGTCTAGGCGATGTTGAGATTGAGCAGCCG
AAGCTGCTCAACGCACAGCTCAAGGAATACCAGCTCAAGGGTCTGAATTGGCTGGTGAACCTGTACGAACAGGGTATCAA
CGGTATTCTTGCTGATGAAATGGGTCTGGGAAAGACTGTGCAGTCCATCTCCGTAATGGCGTATCTTGCTGAGAAGTACG
ACATCTGGGGTCCCTTTATCGTTGTTGCTCCTGCTTCGACGCTGCACAACTGGCAGCAGGAAATTAACAAGTTTGTGCCG
GAATTCAAGGTGTTGCCATACTGGGGCTCTGCCGGCGACAGAAAAGTCCTGCGCAAGTTCTGGGATCGCAAGCACTCCAT
CTACAAGAAGAATGCACAATTCCATGTGCTGGTCACGTCCTACCAGCTGGTTGTGTCTGACGTCGCCTTCATGTCTAAGA
TGCGCTGGCAGTACATGATTCTCGACGAGGCACAGGCCATCAAGAGCTCTCAGAGTTCTCGTTGGAAGGTGCTTCTCAAC
TACCACTGCCGCAACCGTCTGCTTCTTACGGGTACCCCGATCCAGAACAACATGCAGGAACTATGGGCTCTGCTGCATTT
CATCATGCCGTCCCTCTTCGACTCCCACGACGAGTTTAGCGAATGGTTTTCCAAAGACATCGAGTCGCACGCGCAGAGCA
ATACCAAGCTGAATGAAGATCAGCTTAAGCGGCTGCACATGATCCTGAAGCCCTTTATGCTCCGTCGTGTCAAGAAGCAC
GTGCAGAAAGAGTTGGGTGACAAGATTGAGCTGGACATTTTCTGTGATCTGACGTACCGCCAACGTGCCTACTATGCCAA
TCTTCGCAACCAAATCAGCATAATGGACCTAATCGAGAAGGCTACGACAGGGGACGAGAACGACTCCAAGACGCTCATGA
ACCTGGTCATGCAGTTCCGAAAGGTCTGCAATCACCCGGACCTCTTCGAACGTGCCGATACGACGTCGCCTTTTGTCATG
AGCTACTTCGCCGAGACAGAATCGTTTAGCCGCGAGGGTGCCATCATTCCTGTCGGCTACTCGACCCGCAGTCTGATCGA
GTACGATGTGCCGCGCATAGTCGCATCCGAGGACGGACGCATCCACATGCCCGGCCGAAACAACGCAGTGGCTGGTTTCC
GCAACAAGTACCTGAAAGAGCTGATGAACATCTGGACACCCGAAAACATCCGCGACAGCTCCAGCAAGGACGAGGCCTTC
TCGTGGCTGCGATTCGCTGACACCAGTCCAGGCGAGGCGTACCAAGCATCACACCGCGATATTTTCGACCGCGGCGTCGA
TATCGCCACGAAGCACGCTTCCACTCCAGGATTGTCGTCTCGTCTGGATCGCCTGAAGGTGGTCTACGACGATGACGATG
ACAAGAAACATGTTGGTAGCAAGTCGTCCCGGTCCGGATACACTCCAAAACATGCGCTCTTCCAGATCAGGGAGCGCAAT
GGCCTTGCCGCACTTGCCGACATTACGACCGAGGGTGTGCTGCATTCGCTCATGAATGTTGCCCGCACCGCGTACGACAA
CACGGGTCTGACCCGTGTCGAGCAGGCTGGGCGCAACAGCGCGTCGGCACCTCCGATCGAGCTGACCAGCAGCAGCCGAA
GGACTGCGATAGAACGCCAGGACTTGCTCTTCAACATGCCCATGCGGCGGGTGCTGTTTGGGCCCAACCCGGCAGAGGAG
AAGGCCCTGGTGTTGCAGCAGGTGCCATGGAACCGATACCCGTCGACGTCTCTACTGCCAGCACCGGATGTGGAGAAGAA
GCGGTTCACAAACATCTCCGTACCGTCGATGCGACGGTTCGTGACAGACTCAGGCAAGCTGGCGAAGCTGGATGATCTGC
TGTTCAAGCTGAAGGAAGGCGGGCACCGCGTGCTCCTGTATTTCCAGATGACTCGCATGATCGATCTGATGGAAGAGTAC
CTGACATACCGCAACTACAAGTATTGTCGGTTGGATGGTTCTACCAAACTGGAAGACCGTCGCGATACTGTGCATGACTT
CCAGACGCGCCCCGAGATTTTCATCTTCCTGCTTTCGACGCGTGCTGGTGGTCTCGGCATCAACTTGACGTCAGCTGACA
CGGTTGTCTTTTACGATTCCGATTGGAACCCAACCATCGACTCGCAGGCCATGGACCGCGCGCATCGTCTCGGCCAGACG
CGCCAGGTGACGGTATACCGGATGATTACACGCGGTACGATCGAAGAGCGCATCCGGAAACGTGCCCTGCAAAAGGAGGA
AGTGCAACGGGTGGTCATCCAGGGCGGCGGTGCTGCCTCTATGGGTGTGGACTTCTCGGGCCGTCGTGCTCAAGACAGTC
GCAACCGCGATATCGCGCTGTGGCTGGCAGACGACGAGCAGGCCGAACTGATCGAGCGTCGCGAGAAGGAAATGCTGGAG
AACGGGGAGTTGGACAAGGTGGTCAAGAAGCGTGGCGGCGGCAAACGCAAGCGCAATGTCGACGTGGATGGCAACGGTGC
CAGCCTGGACGAGATGTACCACGAAGGTGAGTTTCGCCGTGTGCTTCCTCGTATTGGACGTCGTGGGAGAGTCGAGCTAA
CGGGTGGTGCAGGCGAGGGCAACTTCGACGACAATAAGGCGTCAGGAACAGCAACGCCGATCGAGGCAGCCACGACTGGC
GGCGGAAGAAAGAAGCGTGTGAGCGTCAAGAAGGCCAAGACGACTAAGCAGCGTCTGGCCATTGCCGACGGACACATGGA
CGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62