GenePrediction:GLEAN_3532 Details

Name: GLEAN_3532
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:695829..703220 (+ strand)
Length: 7392
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:695829..695970 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_156:696028..696826 (+ strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_156:696868..697419 (+ strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_156:697505..697762 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_156:698309..698901 (+ strand)
Length: 593
Type: CDS
Source: GLEAN
Position: GCSC_156:699149..700058 (+ strand)
Length: 910
Type: CDS
Source: GLEAN
Position: GCSC_156:700324..700752 (+ strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_156:700793..703220 (+ strand)
Length: 2428
>GLEAN_3532 class=GenePrediction position=GCSC_156:695829..703220 (+ strand)
ATGAGAGTGCTACGAGAAAAACAGACATTGGATGTGCAGGTGGCACGATGGTGTCCGGAGCGCGTGTTTGTTGAGCTTCT
CATTCCTGAGGATGTCCATGCCATGACCCAAATTGTCTTCCGCACCGAGTCTCACGATCAAGGTAAGTGGCCAGAATACG
TGCTGCTTTGTAGGAAGCAGTGACTAAGACCCGGTCTAGGTTACAGCGAAGAGAAAGTGCTCCACGGCACGTACGAAGGT
TCCTTTACCTGGCTTGAGGCCGTTGTCGTCAGTCCGAGCGGCCACGAACGCTGTCCCCGGAGGACGGTTCAGTACAATGT
GCACGCGAGCTCTGCCTACAGGCGCCACGAGGTCGTCTGGGACGCGGTTGCGAGCGCGGATGCGGCGGTGCGTGACTGGG
TAAGGGCCGTACGTGGCGGCGACGCTGTGCAGCTGATCCCCAAGGCGCAGTGGCCGGGCTGGATCAACTTTGTGCGCGAG
GCCGAGATCGAGATTCGGGTGGTCAGTGGGCTTAGTCAGCAGATTGTGACCGGGAGGCCGTCATGCTACCGGCCGCTGCA
GGCGACGGAGATGCGGCTGCTGGTGCTGGACAGCGGAACAACAGATGCACCGCTAAGCTGCACGCTGATGCATGCAGACG
TGCGTCGGCAGCCGGTGGTGGTGCCGCCGTACGAGGCGCTGTCATACTGCTGGGGCGACTCGCGGAAGACGAGGGAGATT
GCGGTGCGGCGGGATGCTGAGTCATCCACTCCGGTGCAGCTACGGATCACGTCGGCACTGTTTGCGGCGCTGCAGGCGCT
ACGCCGGTCGACTGGGCCCGGCCGCATGCTCTGGGTGGACGCCGTATGGATCAACCAGGACGACCTGGACGAACGATCGA
GCCAGGTGGCGCTGATGCGCGACATCTACCGGCAGGCGGACCAGGTGGTCGTGTGGCTGGGCGAGGGCGATGCAGCGACA
CATCAGTCGATCGAGGTAGTCAACGCGATTTGCAAAGAGTACGAGCGACAGCTGGAAGCCGACACAGATGTGCTGGCAGA
CCGGGACAGACGATGCGGTCGGCCTCGCGAGCCCTCATCCCGCCCATCTTCAACGCGCTCTTGGATGCGCGGGAGGTGGC
TTCCCGGGACCGTCACACGCTCGCCATTCTCGACGTGCTCGTGCTGGGCCTCGACCTCGACGTCTCCGACCCGCGCGACA
CGCTCTTTGCCATGCTGCAGTTCGGCCGCGAGACCGCCGATCTGGCCGTCCTGCCGCCGGCCGTCAAGCCCGACTACCGC
CGGCCGACCCCCGACGTCTTCGCCCTGTTCACGCGCTGGTGGATCGCCGAGCACCGGTCGCTGCGCATCTTCTCGGCCGT
CCACGCACTCGAGGGCCGCACCTGGCAGGAGACGCGCTGGCGACAGGGCTGCACGCCGTCGCTCGTCATGCGTGACCTCC
CCAGCTGGTCCTGGGGCTATCGCGGCCACAGCAACTGGGCCACGGGCCTGCTCGGCCTCCCGGAGGACTGCCCCTACCGT
GCCTCTGGGGACTCTGTGCCTGACCTCGAATGGCTGCAGCGCCCGGCCTCGAGGGTCTGCATCGGGCATTTGTGGGCATT
TTTGACCCCCTCAATCTGACCGGCAAGTGGCTCCACCAGCTCAAGTCACAGCACGACCAGAACTACATCGACACAGAGCC
TCAGGGTGTTCGAGGAAGACGACCGCCGTGGCGTGCATCAGCCGCTGCTTCTTCACGGCAGAGGAGGGGTTTGTCGGCTT
ATGTCCGTTTGCAGCGCAGACGGGCGACTGGATCGTCGTTTTGAGCGGCGGTCGGGTACCGTATATTTTGCGGCCGCGGG
ACGAGAGTGGCCAGGAGCAGCACTTTATCGGGGAATGCTATGCGCAGGGGTACATGGAGGGACAGGGCGTTGAGGGGCCT
GGAATGGATTCGCAGTCTGTGTTTTCTCTGATGTAGACAGGGAGCCACCTATTGCGCCAACTGTTGAACGGCTGACTGCA
ATGCCTCAATTAGCATTTCTCTGATACGCCAGTCTTTCGCCTGCCCCTGCTGCCTGCATATTTGGCCTCCACCGTGGCGC
AGCATGATTCGACGGATGAGCAAGACCGGGCATCAGGCATAAAAATCGTAGCTGCTGATGCGTTTTTTCTTTTTTCTTTT
ACCAGGTTTCTTTACCAGCGGATTTATTTTACATCAACAAACTTCCCAATGAAACGGTACTGGTCGTACGAAACCAAACG
TCGTACATCGGCGAGCAATCTGTGCAAAAAGTGTCAGAAAATACCATTTCGGAACCTTCGTGATACCCCAGGCCCGTGTG
ATCTCAAGCTCAATATTACCCTCAAAACTTTCCAGGCGTTACGTGGCCGGTCAAATTGCGTCCTCTGCACGTTTGTACTA
GCTATAAATAAAGAGAAGTCTTCTTTTTATAGGTTTATATGCAGAAAGAGCCACTTTACCTTATGTGCTAAAAATGTCAG
CTTCTGGGCTGACGACCCGATCGTGGTCTTTACGGCCTGTGAGGGAAAATCTACAATATACCGGCAAATCACAAAGCCGC
AAATAGACCCAAGTTTGATTCAGGAATGGCTGGACACTTGCCTCGCCCATCATGCCCAGTTGTGCCCAGCACCAACTCCG
CCAGACTCAGCCCTACACACGACGCACTTTCGCCTTATCGACGTGCGCCGATTCTGCATCGTACCAGCATCGATCCAGGA
CTCGTACGTAGCGCTTAGCTATGTCTGGGGCGAGACAGAAAACATCAGTCTAGAGAATAGCAACAAAGAAGATCTTACGC
GGGAGGGAGGGCTCTTACGACAAAATGTCTGGGGCCAAATCCCCGATACGATCCGTGACGCCATACAACTCATGAGAAAA
CTGGGCCTGCAGTACCTATGGGTGGACTCACTCTGCCTAGTACAGGACGATCCCACTGACATGACGGGGGGCATACAGAT
GATGGACGTCATTTACGAGCAATCGCTCTTTACCATCATAGCCGCAAGTGGAACCGATGCGAACAGCGGCTTGCCTGGCG
TGAAATATGGATCTCGCTTGACGTCGCCAATGTGTGAGCTGGAGCCAGATCTTTGCCTGCTGCGGGTAAAAAACTGGAAA
AGAGATCTCTCCCGTTCGAAGTACAGCGAAAGAGCATGGACGTAAGTCGAGCGCGCACTCAGCATCCAATTACTCTTGAT
TTGAATAAGATGTTTAATCAGTTGCGGGCAGGTTGCAGGAATATGCACTTTCTCGTCGGCGCCTTATATTTCTCAACGAC
ATGGTGTACTTCAATTGCCGAACATGCTCTTGCTCTGAAGACGTTGTCGGCATGCCGGAGTGGGATGGAAAGTATGCTGA
TGTAGCACAACTCGATGACCCACGTCGCAACACCTTTGAACTGTTTTCTCTGATTGTTGGAACCTACGGCGAGCGACAGC
TGTCTAAGCAGGAAGACGCTCTCAACGCTGTAGCGGGAGTCTGCGAGCGGCTAGCACGTAGGATGAAGTGCAAACTTCTA
CAAGGACTACCAACCGCTGCTATGGACCTATATCTGCTCATTAACGTTTGGAGAAGAAAGCGGAGGCCCGGCTTCGCTAG
CTGGTCCTGGGCCGGCTGGACCGGGGGGGTCTATTTTGATCCTTCTCCGAATCTGCCACCGGATCAGATCAGCGCCTGGC
TGGCCGAGGAAACCTGGATTGTGTGGTACCAACGGACGTGCAAGCCGGACGGTGCGGTGCTCGGACTAGTGTGGGATCCG
GCCGAGAGCGCGGGCGAGCGAGGAGATATCAACTACGGCGACAACCGGAGGACTTTCCAGCAGGTCATTGCTCGTTGTGG
TCTAGAAACGAGCTTTGACGATCTTGACACGTGGAAGACGCAGCCGTCAGTGGATCTTGCTTCCGAGTCTATTATTCCCT
CTGCATATCCAGTTCTCCAGTTTTGGACGCTGGTGGTTAGCTACACTCTGACTTCGAAAATAGGCTTCTATGGCCTGAGT
GGCCAATCCGGCGACGAGAGTGGCGCTATTTTGGGGGACTGCTTGCATTATACACTTATTCCAAGCGTAGCTGGCCAGTT
CGCCATCCTCTCTAGGGTCTCTGATATTCACGCTGAAAAAACAGAGACTCAAATTTACAAAGATATTTGCTCGCGGTCCG
AGATCGTGGCGGACAACATTATGTTTTATGCCCTTTACATTGAGTGGGAAAACGGTGTGGCCGAAAGGAGGTGATTCACT
TATATACGTGCAGAATGCTTGACCGATTCGCTCTCTCCGCCCGAGTGGAAAGAGATCGTGCTTGGGTGAGGGGTAGTTGA
ATGAGTGGACATTAGTTTTCAAGCGAGGAAGCGATACTAACGAAACCTGATCTGTGATCTATTATTGAGATGGCGCAAGG
TGGTGTTGGCAGTGGATCCGTTATCTGTGTGACGTATGCACGGGCCATCTGGCAGAGATTTTGGTCTGCTGCCTGTTTGG
CTGTTTGGCTGCAAGGATGCAGCGACGTGCTGAAACAGCACAGAGCGGTTGTGCTTGGGCCGGACAGGTGTGGCACAAGG
ACAGTGGATACGGAGGGATCTGGCAGCAGACGGGTGGTCGAACCAAGAAGCGCGAGGGTGCGCCGACGTGCATTCAGTGG
GGATCGGGCAGCAATAGAGTGGTGCTGTTCCACATCTGCTGGCGTCGGCTCAGCTTTGATGGCACCCTAGGCCAGAGCGA
GCGGGTGTCTGGGTATCCGCAGCGGTGGCGTAGGGAAAACAAAAGCGAGCGTGGCGGCACGCCCTCTCCAGGCAGACCGT
CCGGCATCACAAGCACGCTGGCGATTCCGCCCACAAAAAATGGAGTGCACCCAGCGGCAGAGTCCAGCTGGCTTTGGCCT
GACGGTGGCCGCCAGGACGGCCAGGACTGCGAGGAGAGCAGGCCGTGTCTGCATTGACCGCTTCGGTATCTACCTCAACT
CCAGAGCAAGAGGCACAAAGAGCACAAAGAGCACAAGAAGCACCGGAAGCACCGAGAGCCGGATGTGGTCGCTGCGCAGA
AAGTTGACGTCTCGTGTTGTAGGCACAGCCCGGGGCGACGTCGACGACCCGGCGCCATCGAGCATGCCGAGCATGCCGAG
CATGCCGAGCCTGCACCTGCCATGGCACCTCGACCGGTTGCGGTTCCGGATCCGGTTGCCGGCCTGGCCGTTTGGCCGCT
TGGCCGTCTGGTACCTGCTGACGGGCATGCTGGCAGTCGGCCTGCTGATGGTCTGGCTGCTGGCGGCCTGGCTGCTGGAG
CGGCCACGAACACGCCGCCATGCCCCGGTCGACCCGGAGAGCTGTCTGGTCGACGCGCTCGAGGACGCGGTCGAGCACGG
CGATGGACCCGGCACCGAGCGGGCCATCGAGCAGGGCGTCGACATCGACCACGTCTACAGCGACGGCCTGACGGCCCTGC
ACCTGGCTGCCGAGTACGGCCACGTCGACGTGGTGCGCGTGCTGGTCAAGCACGGTGCCGCCTTCAAGACGGGACCCATC
GGCGCCACGCCGCTCTTCTTTGCCGCCCAGCGAGGCCATGCCGACATCACCCAGCTGCTGCTCGACCATGGCGCCGACAC
TACTGCTACGCTCTACAACGGTTACACCCCGCTGCACCTGGCTGCCCAGAACGGCCATGCCGAGGTCTCGCGCCTGCTGT
TTGTGCATGCTGCCGGCCTCGAGACCGTGACCACGACCGCTTCCGCTTCCACGTCCGCGTCTACGCCCACCCTCTCTCCC
CTTCACCTGGCCACCTACTTCCGCCACACCGCCGTCGCTGCTGCCCTTTTACAGGCTGGCGCCAGCCCCAACGTCATCGC
CGACGACGACGTCGCCCCGCTGCACGTCGCCGCCCAGACCGGCTGTGCGGACATTGCCCGTCTGCTGCTCGAGCACGGCG
CCGACATTCACGCCCTGTTCGACGACGCGTCCACGCCACTGCACGTGGCCGCCCGTGCTGGCCATGCCGACGTTGCCGCT
TTGTTACTGCAGCTGCACGCCGACATCCGTGCCCGCTCCGATGACGGGTCCACGCCGCTGCATGAAGCTGCTAGCACTGG
TCACGACGATGTTGTCGGTCTGCTGCTGCGCCACGGCGCCGATATCCATGCCCGCCAAAAGGACGGACCCATGCCGCTGC
ATCTCGCTGTCGTTGCCGCCCACACGGCCGTCGTCCGTCGGCTGCTCCGTTCCGGTGCCGATCCCAATGCGCCTGGTGAC
GATCAGGGCACCACGCCCATCCATCTTGCCGCCCAGACCGGCTGCGTGCCCGTTCTCGCCCTCCTCCTCGCCTCTACTCA
CTCTACCACACCCCCCAACTCCTCTGTCAACGCCCGCCGCGCCGACGGCCGCACTCCTCTCCACTTTGCCGCCCACGAAG
AGCGTCGGCTGGCCGCCCGCCTGCTGCTCGCCCATGGCGCCGCCGTCAACCCCATCGACGACTATGACGCCACCCCCTAC
GACGAGAGCATGCGCCAGACCCAGACTGTCGCCGACCTGCTCGTCTGGCACGGTGGCCGCCCCGTCGACACGTCACGGCC
CGGCCTCAAGCGCCTCGGCGATCCCGCCACTCAGGATGGTCACGTGATCCGACACGCAACTGACATCTATATGCTGGAAG
ACCAAGACGATGACGGCGACGACAGCAACGAGAAGATGTCGCTGCTGCACGCCGCCTACGAGGGCGACAGCGCCGTGGTG
GAGCAGCTGCTCCGCGCCGCGACAGCGGACCCCAAGGTCCAGCGCAGTCTCGACGGTGCCACCGCTCTGCACCTTGCCGC
CCAGCAGGGTCACGTGACAGTCGTGAAGCTGCTGTTGGAGAATGGCGCCGATGCGAGCAGCAAAACGCTCGACGACACGA
CAGCGCTGCACCTGGCGGCTTACTACGGCCACGCCGACGTCACGACAGCACTGCTGCAGCACGGCGCAGCCGGCACGGCG
TGCAACGCCGACGGGATGACGGCGCTGCATCTGGCCGCGCAGCAGGGCCACGAGCCGGCGGTGACGCTGCTGCTGACGGA
GAGCGACGCCGATGTCGATGCTGCCACTCGCGGAAACACGACGCCGCTGCACCTCGCAGCTGAGAGCGGCCACACTGGCT
GCGTGGGCCTCCTGCTGGCCGCCGGTGCCACCGTTTCGGCCGTCACCCGCGATGGTGTCACACCCCTGCACCTGGCTGCT
CAGGGCGGCCACGAGGCCACGGCGGCTCTCTTGGTTGAGCATCAGGCCGACGTGCGCGCGCATGTCCGCCGCACCGGCGC
CACGCCCTTGCACCTCGCGGCCGCCCGCGGACACAGCAGCGTGATGAGGCTGCTGACGCGCAGCGGTGGCGCCACACACG
CCGAGCGCGAGCCGACCGATGGGCCGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62