GenePrediction:GLEAN_3533 Details

Name: GLEAN_3533
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:707198..712887 (+ strand)
Length: 5690
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:707198..707238 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_156:709673..710015 (+ strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_156:710058..710947 (+ strand)
Length: 890
Type: CDS
Source: GLEAN
Position: GCSC_156:711828..712887 (+ strand)
Length: 1060
>GLEAN_3533 class=GenePrediction position=GCSC_156:707198..712887 (+ strand)
ATGGGTGCGGACATGCGGAATCTCTACAGCCAGGACTGGCTGTGAGTTGACACCTAAGAAGCGGCATTTTGCTCTGCTGG
CAAAAGGAGGTTGTCGGGCAGTACTCGTAACCAGCACAAGTAAGCACTGTACTTAATCCGGTGTATCGTAGAACCCGAAT
ACTACGTAAAGTGGGTGGCTCCCGATATAGCTTCTAATTATCGCCTGTGAGTCACTCGACCCGTCCAAGTGGCTTCAATA
TATGCCAACGCAGACATACATTGTCCCCCTGCGGCTTTTCCTCTTTCGACCCCGTGACCACATCCAAATCGTCGTGTGAT
AGTTGGCACGGGGCATACGAGTACGACAAGCCACCCTATCGGGTTGGCTGTTCTACGAATTACATGCAGGCCCGTATTTC
GGGTTTTAAGCGCAAGAAACATGCTGTATGCGAGTGCGAGTGCACAGTTTATAAAGCACTGTACGCACTGTATATTTCAC
TCTGAGGCTGACTTTTGAAGCAAGACGCTAAAATATGATCTAGGTACAGAGATAGGTGAGAGGAGAAAGAGACGGGAGAG
CATACGCGTTTGGCATAGATAAAACTAAGACTAGATGTATGCCCTCTTAAGATAAGAGAGGTTAAAAAGACTATATTTCG
TTTCCTCCGGGTAATCAGCTGAGCTGGCCCGCCAGCATCAACGTTTTCATGCGAAAAGTCATCTGAAGACGGACACCTCC
TTTGTCCCAAACGCAGGGCCTTGTGCATCTGGCCTGTTTCGGTTGACCGTTGTGAGGTTCGCCTCTTTCGACAACCATTA
GCAGAAGGGAGATTGAGCACCTGAGTACACTGAAGCTTTCCTTTGCTATGCGGAGTACACCCCGCTTTGGCCAGAACGAT
TTATTTTAGCAGGCTGTTTGCCGGGCTTTTCTTTGCTAGCATCGGCCCAATTATCATTCAATCGTCCGACATGGTGTAAT
GGCTAACATCGGTCGCTCTCACCGACCAGCTCGGGGTTCGATTCCCCGTGTCGGAGCTCAAATTTCATTTTTGCACTCCG
AATAACAATCGCGGGTGTGTTTTTTTTCAACCGAATTTAGCTATGAATCGAACTTAAAGGAAACCTGCAATTATCTCTAC
GCAAAGGCATTTTCTCAAACAAGAAGGCCCTGGTGACCCTTGTATTGGCAAAGACTGTCACCCAGGGAGCTCTTTATACT
GACTGCTTAAGTACAGACAAAGAGTCTCGATCGTGGTAATATGCAGTCTTCCCCGAACATACTATCCTGTTTTAAAATGC
TGACTTCGCCTTGACCACCAGGACCTCCGTATATGCGCCCTGGAATGTTTTCGTCAATCTCTCATTACTGAGCTTTCGGG
CTGATGGATTTTCGTATTGAGAAACTTTGAAACAGTGCTTGCACTTGCGTTGCCTAGATACGGAAACAAAATGGGCGAAG
ACGCTTAGATTTCTTCTATATCTGTGTTTGGGTATGCTAAATCTTCTTCTCGCTCATATTACTGGTCACACCTCCACGAT
AATGCCTACTTCGGATCTAACTATTCTTCGTCGACAATTTTGTGCCGCTCTGAAAGCCAAAATACCGACATGTCTACTTT
TCAAACACAAGTCCTTCACATGGTCTATGAAGTTGTGTCGAATAAACGGCTTATGCTGTTCGAAGATACAAGACACATCA
GTAACTAGATAAACCATTCTGCGTACTCGTCTCTTCAGGAAACTCGAACAAAGAGACAAAGACAAAAGTAGATATGGAGC
TAAATCAAACCTTGTACAGCATCATCACCATTTGCAGATGCGTTCCACGGCGGCTTCTGGGGCACTTCCAGTTTGAACAG
ACAATTAATATATCCTGGCTTGTTCACAAGGATTTCATGTGCTTGGCAGAAAGACGAATATGAAATTTAGCAATGAACAT
CACGAGCTAGACCGAATCCACTTCACCTGAACATCATCCTTTGACTGTAATGACTACATAAACGCCGACAAAGATCGTCC
TCTGTCCATCGATCATGCCCATTTCATCCACGACAAAATAAAAAGGAACTGGCTGGCACTTAGGCAGAGACCAAAGCAAG
CAGAAGGAAAACCAAATCTCACTGGGAGTTTTTGTTGACGCAAGTTAGAGCCGCCTCAGACTTTTCGTGGCCCTCGTGTC
TTGACGCGTGCTCGGGAGTTCTACACGCGTCTACTGCCGCGTAACTTCCCTTTCAGGCAGTGAGTTTTTTCCTCCAAGCC
TTGTTGTTTCTCCTGCCCCCCCAATTTGCCGAAGATCCATTCTCCGTCACTATAAGAACTACTCTAACTCTGCATCCAAA
AGCCTCCCTTTTCGAGCAGACAGGTATGCCCCCCCTCCCTCCTCCCCCATCAGCTAGCCTGGTTCTACCACTGTCATCTT
TCTGCCCTTCTATCATTCTGATACGTTCATCCCATCTCTGCTGCGCGTAAACGGTTGATGCTGACTTGACCCCAGAGACA
AAGCACGAAGCGGGAAGGACCAGATTGAGCCGGCAGGACTGACTGTGATGGACTCGCAATTTCTCGCAGCCTGCCTAGTA
AACAAATGGACAACTGTCTTCATTGCTCTTTTCATCTGGAGATACCTTCGCCAGGTGGTCCATCTTGTCTCCTTCTGGCG
GTATAGACCGGCCAAGATATCGGACGATCCAAGCTTCACGGCAAGGGATGTGACGATCATCCTCCCTACCGTCGATCCGA
CGAACGGTCTTTTCACAGAGTGTCTCTTGACCATCATCGAAAATGCACCGAGCCGTGTGATCGTTGTGACGGCTGGCGAG
GCGTTGCGCCTGCAGACGGTCTCTATCGTGGCTGACGTTCGACGACAGGTGTCAGCTTAGGGGCTTGACACCACGATCGA
TGTCATTGCCGCGATGGAGGCCAACAAGCGCCAGCAGGTGGCCTACGCACTTCAGCTGGTCACTACTGCCATCGTGGCTC
TGGTCGACGACCACGTCATGTGGACGGACAAGTTCCTCACGTTTGCCCTGCCGGCCTTTGACGATCGTCGCGTCGGCTTG
GTCGGCACCAACAAGCGTGTCTTGCGTGAGACACACCACAGCTCCCTCGCGCACCGCATCCTCAACATGATCCAGTGCCT
CTACCTGGAGCGTCACAACTTTGAGATCCGCTCGACCAACGCGGTCGATGGCGGCGTCTTTGTCGTCTCCGGCAGGACCT
GTCTCGTGCGCTCCGAGGTTGTTGTCGGCACGGATTTCGTCGAGAAGTACACAAATGACTACTGCTTCTTCGGGCTCATC
GGCCCGCTCGGCGCTGACGATGACAACTTTCTGACCCGCTGGTGCGTCGCCCACGGTTGGAAGATCCGCATCCAGTACTG
CCCGGAGACCCTCGTCACTACTACGCTCGGCAGCTCCTTCAAGTTTGCCGGCGGGCTCCGGCGCTGGGTGCGCACCACCT
GGCGATCCAACGCTATCAGCCTCGTCCATGTCCATGTCTGGCGGGCACAGCCGTGGTGTGTCTACGCTGTCTACCTAACA
TCCTTTACGAACTTTGCCCTCTTCTACGACATCGCCCTGATCTACGCACTGGCTCGCTCGGGCTTCGTGGATGGGCACTC
GTGCGGGGCATTTGCCTTCGTCCCCGTCGTCTTCTGGATGGTACTTTTCAAAATGGTCAAGCCATTTGCCTACTTTTGGC
GCCACCCAGAGGATGTGATCCTGATCCCAGCATACTTCCTGTTCACCTGGGCCCACTCCTTCATCAAGCTGTGGGCTCTT
CTCACGGTGTGGGACTGCAGGTGGACCGGACGCAACCTTGAAGCAATCAACCAGACGTTGGAGAGACGCGAGATGGCAAT
CTTGGACCACGGAACCAACAAAATTGTGGTGCAAGAAGAAAAAAGAACAAAAGAACAAGACGAAGAAAGCGAGACGATGT
ATAGAACGAAACGGGGAAATCGGATCCCCAGAGCACATACAAAAACTACAGCACTCATCAAGATGAAGTGCTCGGCCGAT
GCACAACCAATTGGTGCTGCCGAAGATCAGTTTCGGACAGCAAGGACATATTGACACGAATCACCATGTACTCGTTGGAG
CGGATAACCAAAAGCGGCCAGATTCGATCATATACGATACGATGTTGGCAAATACTGGACATATACAGATACTGGGCTAT
TTGTGCTAAGACAGGAATTGTGTTTGATTAAGGGCTCCGAGATATGAGCTAGATTTTGTCAGATAGTGTTGAAAATTGAA
GCTGTGGCAACAGGTTTGGACATAAAATGCCACAATTTGCCTACATCTACGTCTGGAAAGAGCGTCCGTCCATTTTTGTA
CCTAGCGGTATGTCCATTGGTGTTTGCACCTTCGCGACAGGGCCGCTCCTTCTCTAATGGCCGAGTCGAGGGAAGGGTGG
TCTGACGACCTTTTTTGAGAGAGCAGAGTTCAATTCTGTTTGTGCTTGATCTACTACTTTTCAAATAGCAAGCTCACTGC
CAATCAGTGTTTTTTTTTGGTCCTGTATCGCATGCAATAGCATTACGAAAAGCAACCAAGCGAACAGAGAATCATATCTG
TTACAAAAGGTAAGACAAAGCACGGGGACGGCAGTTCTTATTTGGCAGCGAATAATCACTAACCATGTAGCATTTCCACC
ATGAAACCAGGACCAGCACTCGCCATCATCCTTCTCGGTGGTGCCAGCAACATTGCTGATGCATTCCCGGCTAGCCATCA
CCAGCAGTCGAACGCTACCCAACGACGATACCTGCATGGCCTCACACGCATGGCCCAGTCGACGGTCCTCCTGGGTGATC
TGGCCATTGATGGGGCAACGACAGAGTCAGGCCAGGCGATTCAGGCCATCCTCCAGGGCACGGCGTCGGCCCGGGTTGAG
AACGAAGAAACATACAGACAGCCTTTGGGTGGGCCCCATGTCAAGGCTTGTCACGAAAACACATGCTGCGTCTGGAGCCA
CATTGTGGCGCAGATGACGGCGACATTCCGGTCAGCTGACGGCCGACACTGCACGGCTCTGGCACGGAGTGCGATCCGCA
TGGGCTACCATGATGCGGGGGCCTGGAACACGTCGATGCCACGATTGTCGGCCGAGGCAGTGGCACACGGCATCGGAGGC
GGCGGTGCGGACGGGTCAATTCTGCTGTCGGATGGCGAGCTGAATCGGACGGAAAATCGCGGACTGCAGGACATTGCCCA
CTTGGTGATGAGCTGGTACAATGTCTACCACTGGAGCCATGGGGTGTCGGCGGCGGATCTGATCCAGATGGGTGCACTTG
TGGCCACGACGGCCTGTCCGGGAGGTCCACGGATCCGTGCTTTTGTGGGCCGTCACGACGTTGAGCCCGGATCACCACCG
CCACCGCATGGGCTACTGCCACCATCCTCGTCGGACGCGCCGTGGATGCTGTACGTGTTCAAGGCCAAGACGCTGTCGCC
GGCTGACCTGGTGGCACTTGTGGGGGCGCATACGGTCTCGCGGCAATTTTTTGTCGACACGATGTACGCGGGCCAGGCAC
AGGACTCGACGCCGGCGGTGTTTGACACGCGGTTCTTTGACGAGACGACGGCGGCCGAGAAGTCGCCCCCGGGCGTCTAC
AGCTTCCACTCAGACATGTCGCTGGCGGCAGACCCGACAACGCAGCCGATTTGGGCGAGTTTCACAGGGGAAAACGTGCA
CGGCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62