GenePrediction:GLEAN_3534 Details

Name: GLEAN_3534
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:713912..714852 (+ strand)
Length: 941
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:713912..714017 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_156:714083..714852 (+ strand)
Length: 770
>GLEAN_3534 class=GenePrediction position=GCSC_156:713912..714852 (+ strand)
ATGGTCGGACGGGTTATCGACATGCGGCATATTGACCGCAAGGAGCTGTACACCAGCCTGGATGCCCGGATCCAGTACCT
GCACAGCTTCCTGGACTTTAGCAGCAGTACGTGTGTGCATGTGCTGGCATGACTGTGCGGAGAGGCGGCTAATCTGAGCG
ATTCTCTGCAGCGGACATTGACCATCTGGTCGCGGGCGCCAAATACATCAAGGTGCTGATCCCGGCGGTGACGAACATTG
TGTACCGCAAGCTGCTGCAGTACGACATTACGGCGCGGGCGTTTGAGACGCGGTCGACGTCGTTTGAGGGTCCGCTGGAC
GCAGTGCCGGCCGAAGACTCGCCGCAGATCCTGCATCGCAAGATGTTTCTGCGGGCGTATCTGGCGCGTCTGTGCAGCGA
CCCGTCGCAGATGACGTTCTGGGAGTATCTCGACAAAGTCGGCATGATGCACGTCGGTCTCGGGCGAGCGCATCCGCTGC
ACGTCGAGTACATTCACATTGGCGCGACCCTGTCTCTGATCCAGGACGTGTTGACCGAGGCGGTCCTCAGCCATCCGCGT
CTCTCGATGGGCCGCAAGATGGGCCTCGTCAAGGCGCTCGGCAAGGTCATCTGGATCCAGAACGACCTGTTTGCCAAGTG
GTACGTGCGCGACGGCGAGGAGTACACGGACGGCGTCGACTACAGCAAGCTCATCGACCGCGAGGGCTTCCTGCACGGCC
AGCGCATCCTTGCCGCCGACGAGAGCGAGAAGAGCAGCGAGCGCGGCGACGACGACAGCGAGCAGGGCACGGAGCGCGGC
GAAACAGCCGCCCTGCCCGCTGACGGCGTCTGTCCGTTTGCCAGCATGGCCAAGACCATGGCGCCCAGCCTCAAGGCCGC
CGGCAGCGCGATACCGGTGCCGGTCATCGTGGCCGATCCGGCTCCTGGCACACAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62