GenePrediction:GLEAN_3536 Details

Name: GLEAN_3536
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:718696..720465 (+ strand)
Length: 1770
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:718696..719375 (+ strand)
Length: 680
Type: CDS
Source: GLEAN
Position: GCSC_156:719448..720465 (+ strand)
Length: 1018
>GLEAN_3536 class=GenePrediction position=GCSC_156:718696..720465 (+ strand)
ATGCCGTCCCTCCACATTCACCTGCCCTCTGCGGCCTCACGACAGCCCGCCTCCCCATCGCCATCCTCACGCCACCCCAT
CGTGTCCGCCAACTCCACGACCTCTACGGCCTCTACCTCCTCTTCTGTCGCCCTGCGCCGCTTCTGGTCCCCTTCACCGT
CCTCGCCCGCCTCTCCGACGACCTCGGCCCAGACCCAGACCCAGTCGGCTCCCTCTTCCCTTCACCTCAACGATGACCTC
TTGTCCCGCATCCAGCAGTCACGCTTTCAGCCAGAGTCGGCCCTCTTCACCCTGATCCCGCCCCTGGTCGACGCTGCTGC
CGGCACTACGGTTGTCCCGGCTTCGTCTATCCGTCGTCTGCTTGCCGACCTCTGCTGGCTCGCCCGCCACCTGCCGGCTG
TTCTTTCTGCCACGGCTGAGCCCACCCTACACACCGTCCTGCACATCGCCCTGACCGTCGGTAGTGCTACCCTGCTGCTG
TGGACACCGCTGCTGCTGGCCTGTCTGCCGGGCTGCCTCTTCATCGGCTGGCTCGTCACCATCGGCTTGGGCGCACGACT
GGCTTCGGCACCGCTCAACACGGCCCTCCCGGCCGTCTTCCACAGTCCCTGGGCCTCGGAGGACGATGCAGACGTTGAAC
AGGACGAGCATTGGTTCTTTGTCAGCGGCATCGGCATCAGGTGAGAAGACACGTGACACAGACCTCGTAATATCCTCATG
TCACATGACATCTCACAGCTGACACGCCCCAGTTCTGGCTCCCTCGCCGTCATGATGCCGCGCCTCGCCGCCGTCTTTGG
CCGGCCCATCACGCTCATCCGCCCTGGCCGGTCTTATGGCGTCTTTCTCGACCTCGCCCGCGCTTTTCTGCACCGCTTGG
ACAGTCGTTTGCCCGTCTCCGGTGCCGACGCCCTGCATTCGGCGGTGCGCCAGTCTCTTCGGCCGATGCCGTCGTTGTCT
TCGTCCACGAGCAGCCGCGGCCGCCGCGTCGTCATTCTCGCCCACAACGCCGGCGCCATTGCCGTCTCCCAGGCTCTTGC
CCGGCTCCTCGTCGACGTCCCCCCCGCCTGGCTCGCCCGCCTCGAGATCTACACCTTTAGCTCTCTGGCCTCCGACTTTG
CTCTGCCCGCAGGCTTCTCGACTACCACCACTCCCCACGTCGAGCACTTTGCTCTCGCCGATGACCCCTTTGCCCGCTTC
GGCATCTTGCGGACCGTCCGCGAGGACCTCTCTGTCCGCTGCTGTGGTGGCGTCTTTGTGCTGGGCGAATCAGGCCGGCC
GCGAACGCCGCCGCTAACCATATCTTTTCACTCTTCTCGCTTCCACATGGAGGACTACCTCACCACCCTCTTCGGGCCCG
AGCCCTGGTCCATGCGTCCCGACATTCACGAGGGCGGTGCGGTGCAGCGCCGAGACACCGGCCTCCTCGACGCCGTCGTC
ACCGTCGACCGCGACCTTGCCGAGAAGCGTGAGATGCACGCCCTCGTTCAGGCTGCGCCGTGGCCGTCAACCAGAAACCG
CCTCAGCTGGACCGGTCTCGGCGCCACGGCCGCTGTAGACGACACCATCCGCAAAAGGGATGACCCTTCCCATCCATATC
ACCAACAGAAGCGCCAGGGAATTCTGGGAATTCTGGGCCTCGAAACGGCCCGTCGGCTGTGTCGCGACTACAACAACAGG
CCTGGTCGTGCTATCAGTCGGTTGTTTGGCCACTATGCCGATGCTGTCGTGCGCCATGAAGAGCGCTACGGACCACGTGG
TATGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62