GenePrediction:GLEAN_3537 Details

Name: GLEAN_3537
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:723986..724628 (+ strand)
Length: 643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:723986..724117 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_156:724186..724325 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_156:724451..724628 (+ strand)
Length: 178
>GLEAN_3537 class=GenePrediction position=GCSC_156:723986..724628 (+ strand)
ATGGTGGAAAATATGCTGGCGGAACTGATGGAGGGGGTCGAAGAATTCTTGAGGCAAAACAGGGAGATCATAAATGAGAA
CAGAAACTCCCTAAATTTTACACAGACAAGCAACTACAGCCCCAGAGAGCAGGTAAGCGCTAATGCTGTGAGCCGCGATG
CCTTGACAGCTTCCAATCTAACACAACCTTCTATGAGCAGGACAGGCAGCGCGAAGACATGCACCGACTAATCAACGCCA
TCCATGAAGATCAAAAGACCAACTTCCTCGGCTTACAACGCTTTACCGCCACGCTGGCAGACGAAGTAAAACATCAGCTC
CTCTACCTGGGACAGCAAGTGTACGTCTTGGGCCAGAGTATCTCGGCATATAAGGCCCAAAAAACGCAATTCCCCAATAC
TGAGAATATGTATGGCACCCTCACGGGTCAAACGCACACACAGTCGCACGCCCGGCCCCGTACAGTAACCGATCCATACC
GAGACTACTCGCAACCGAGCCCGACTCTGCCAAGCTACCATCAGACAGTGCAGAATCAGGCAATCCAGACACCGGCTCAA
TCGCCGGGGCAAGGACCAGTAGTCCAAGGCTCACCACTCCCATGGCGAGGAGGCCAAAATCCCTCCAACAGGACTGGCCA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62