GenePrediction:GLEAN_3538 Details

Name: GLEAN_3538
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:733596..735382 (+ strand)
Length: 1787
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:733596..733760 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_156:733854..733954 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_156:734020..735382 (+ strand)
Length: 1363
>GLEAN_3538 class=GenePrediction position=GCSC_156:733596..735382 (+ strand)
ATGGAGACGGGTACAAGACAGACGTCGACGGCGGCAGATGAGCAGCAGACGCCGTCGTCGACCGATTCGAGGATGGCGTT
GAGCCCTGGCTCACCGGGCATGCGTGATTCTCCGCAGCCACGCAACCAAAGGGCATGTGATTCGTGTCGGTCGAGAAAGG
TCAAGGTAAGAAGGCCTTGTGCACTTCAGTTTGTGGTTTCGATATGTTGCAAATCGTGCCTTAGTCCGACACGCTGACCA
GGCAACTCGTACGAGCAGTGCCGCTTCAGCGATGGAGCCACGGTGTGCTTTGTGTGCGCCAGCCTCGAGATTCCCTGCAC
GTTTGACAGGCCGAGGAGGAAGCGCGGCCCCCCGAACAAGTAAGTCCGTAAGCCCTGCCGTGCTTTCGTCTCGGCACTCG
AGCTCACCGGTGGCCGGCGGCCAGACATGCGGAGGCAATCCGCAGCGCGATGGCGTCTCAAAACGCCAGTTCAGGCGAGC
AGAGCTCACCGTCCGAGCTGCGCACAGTGGTGCTCGCCGAGCGACCGGCCTCTTCGTCGGCCAGCAGCAGTGGCCCCTGG
CTGGACAAGTTTGCGCCGATGGCGACGATCGACCAGCTGCTGGATGAGTGGTTCCAGCACATCTACCCGGTGTCGCCGCT
GCTGCACCGGCAGCGGTTTATGCACCGCTTACGCCGTGGCGATGCTGACAGCGACCGGTTCTTCTGTGGGCTCGTCATCA
GCGTGTGCGGCGCGACGGTGTCGACGCTGCGGCGGTCGAGCGCCCAGCCAGTGACGATCCAAGACTGCGTCGCGTTTGTG
CACCGCCACGGGCTGCTGCGGCGGGATCTGTTGGAGCCGGAATACCGGCTGGACTGGTGCATCGCCATGTACAACCTGGG
CAGTGCGTATGCGTCGACGGCGGCTATAGACGACGCGGCGGCCTACCACATGGGCTGCGAGGCCGTGGCGGGTGTGCGAT
TCCTGGCTTTCTACCGGCTCGATGAGATGATTATGCTGGAGCAGCAGCAGCTTAAGCGGCTCTTTCTGCTACTGCTGGCG
TGGTCCTGCTCGGCCGACCTCTTTGGTCGGGTGTCGCTGCCCATGTTCCTGTGTGATGAGCCTTTCCAAAAGCTGGTGCC
GCTGGCACTGTCGGACGAGCAGCTGGACCCTGACATGGCTGGTGTGGCGCCATTGTGTGCCGATAATCCGCGGTGGCACG
GCGACCGGGTGTCGTATGTTCCCGGCCTGTTGGCCCTCAGTGAGCTCTTCCTGGTGTGGCGCGACGCACAGCGACGGCGG
CCAGTGCCGGTGGGCGAGCGAGAGGCACAGTTGAAGCAGCATCTGGCTGCCATCGAGAAGATTATTAGTCAGCTGCCGGT
AGAATTGCAATGGCGCAGCGGGTTGCCACGGCCGGCACACGTGACCGCGGGCCACGATGTGCAGGTGGCCAACATTTTTG
TGACTCGCCTGCATCTGCGGTCGAACCTGCTGCAGACGTTTGGCGTGGTGGATGGGCTCGAGTACGGCCTTATTATGGAT
AGCATGCTCGAGATCCTCGACCACATGCCCAACATCGTCTTTGAATCCAACGGCAGCAGCATTGTGCCCAAGATCCGCGA
TGTCGGCGCTGCTTACCTTCAGCATCTGCAGGTCTGCCAAAACAGCAGCACGGACGCCTGCCCTGGCGATGTTGTGGCAA
GCGAAAAGTTCAACCGGCTGCTGCTTAAGCTCAAAGACCTCGACCTCTGGCCCGGCATGACGCTGCCGTCAAATACACCC
AGGCCGGCCGGCGGCAGCGTTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62