GenePrediction:GLEAN_3540 Details

Name: GLEAN_3540
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:741565..743661 (+ strand)
Length: 2097
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:741565..741638 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_156:741936..742276 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_156:742375..742392 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_156:742474..742591 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_156:742665..742912 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_156:743001..743283 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_156:743350..743538 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_156:743625..743661 (+ strand)
Length: 37
>GLEAN_3540 class=GenePrediction position=GCSC_156:741565..743661 (+ strand)
ATGTCGGTTGTGTTTGTTTCCGAACAGGGTGGCAATGCTCGCACAAACCTTCGCTCGTTATTCCGCATAGTGTTGTGTTC
ATATACTCCCTCGCCTTACAGCGTGGTAGGCAGGATTATATACGACTAACCTTTATCTAAACACAGTCTTCACACGGGAT
CTGCCCTTGGGCTCGGGCAGGAAGAATCCATTTTATGTATAAGGATCATTATCGCCCAGGCTGGCGATTTCTGGTCGTTT
TGAGCACCGAGAGGCTTGGAGAAGACCAAGATCTAGTGTCATATCCCCTGCCCATATATTTAGGTCTTCGATTCAAGCAG
TCAGACCACGGCTCCAGGCCGCTTAGTCTGCGCTGCCACATAAAAATCCAGTCCCAGCGTGCCCCTCCCAACTCCCCCGG
GGGACTTCATCGGCCGCCTGGCAAGCACCAAGAACGTTCCCGCCCGCCAGGTTGTTACCCCCTACATCGCCTACGAGACC
GAACTGCGGCACAAGTTCGCCGAGGGACAAAATATTCCGCAAAATGCCAACATGATACCCATCTACGACGGCCATGAGAA
TCTCGTAAAGTTTTGCCATCACGGCCGCAATATATTGGACAAGACCAAGTATATCATGCCGCTGCCGCAGTCGCTGACGG
GAAATCACGGCGATCCGGCAATCACACTGAGCCTCGCTGACTACCGGAAGAATTTTCGCGCTTTTACTCACGGTGAGCGG
TGAAATCCTCTAAGCGGCTACAGAGACTCGTCTTTGTTTCCATAACCAAGCTGATAATGAATTCCACCCTTTGATTTCTG
CTCATTTCAGGTCTCTTCCACGACATGGGTAAGTTCGATGAGTCTTTGTACTGCAGATGATAATTGCACTCGTCAAAAAT
CGCTGACAAGATGTTCAACTTCACTACAGATTGGGGAAACATGGTCGTCGCAGGCTCTTCTGCCCTTCTGCCTCTACTAC
CGTATCGGGAAAAGCCGAGCCGGCCCAGGGTGCCGACAGGAAGTAACCCGCTCGAGGAGTACTCTTAGTCAGCATTGCCT
TCTTCATCTCTCCAAGTCTGGTTCTTTCTCTCTCATAGTATCTCCTCTCCTCCCCAGAAGCACTGCTCGGTACAGCGACA
TCGACATATTCCTCTACGGCATAAACGAAAAAGAGGCCATCAACAAGATCATAAATATCAACGAGATAATCCTCAGAATA
TATCAGTCCCCCAGCGAGATCCTCACTGGGTTCGACGTCGACTGCGCCTGTGTCGCCTACGACGGAAATCAAGTGTTAAC
AAATCCTCGAGGTATCACGGCCATTGTGACGCGCACGAACGGGATTGGTATCACCCGACGGAGTCCATGTAAGTGTCCAT
CTCGTTTCACCCCCTTCTCTCTTCTCTCTTCTTTTAGCGCTTCACTCTGATACATTTCACCCCCTCGCCTCCTCAGCTTA
TGAAAATCGCCTCTGGAAATACAGACATCAAAACTTTGACGTTTACTGGGAAGATCTCGACCGAAGACGAGTCCGCATCA
AATTTCCCGATGACGGCCCCCAACGTGGTCTTGCACGGCTGCTCATGTTTGAGAAAAGGGCCGCCAAGGGCCTCCAGACC
CACTACATAATTCAGAGGCACGTCGGCCGTGTCGACGACAACGGCGATCCCTCGCAGGCGGATGCCAGCGGATACATGCG
GCAGGAGCTGCCAATGGGGGAGAGATTTACATCTCAGAGGTGCGGTGTAGAAGAGAAGAGAACTGACAACTGAAAGTCAA
GTTTCTGATAAAGCCATATTTCCAGCGTCCACAACTATGTCGTCAAGCACTCAAAAGAGCCCTACTATTTCGGAAACATC
TCCCAAGTCTGCACCGTCGGTAACAAATCAGGATCGCACAAGAACCCGAAGCTGATCGGCAAGATCCCTTTTATTAAAGA
CAACCCAGGGCGCCAGATGATCGGTAGCTTCTATCCTTTGACAGCCAACGACTGGTAGGATGGACCAAAGTTCATATAAG
ACTTCTCGTATCTACGCATGTGCCTTTTACAGATGCTAACCTTTCTCTGTTTTTCTACAGGACAGCACACGCGTACAGGG
CGCGGAAGCACAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62