GenePrediction:GLEAN_3541 Details

Name: GLEAN_3541
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:747278..749538 (+ strand)
Length: 2261
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:747278..747695 (+ strand)
Length: 418
Type: CDS
Source: GLEAN
Position: GCSC_156:747744..747857 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_156:747925..748030 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_156:748084..748428 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_156:748483..748680 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_156:748745..749147 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_156:749206..749538 (+ strand)
Length: 333
>GLEAN_3541 class=GenePrediction position=GCSC_156:747278..749538 (+ strand)
ATGGAGGGGAACACACCGTCTGTAGCTCTGTCCGAGCAAGCTGCGCCGCTTCTTGGAGTTGAACAAACTGAGGATGTTTC
CTACAATGGGTGGCAGGAAGAAGAATTACAAGATGGGGAGCCCCTCGTCCACAAGCGCGCCAGGTGGCGATGGAGCCTCT
ATGTCCCAGTTTTGACCATCTTGGCGGCTCTGGCCGTCACCTCCACTCTTTTTGTCCTTATCACATACTCTCCGGTTGTG
CTGCGGGTGCCAGAAGCAACATCATCGGCTCCAGCGACATCAGACAGAGCTATCAAGCTCGTGCTTCATCCGGAGGATCA
TGTTTCACGCGAAGCCAAGGCCACCCGCTTGTCGTGGAACATCACCATGGCTCGGCTAGCTCCAGATGGTGTTCAGAGAG
ACGTTATTCTTGTCAATGGTGAGAACTATATTCTTAATACAAGAGCGGCCATTCTGACTCTTACAGGCCAATTCCCTGGT
CCTACGGTCGAAGCTCGATCCGGCGACACTCTTGTGATTGAGGTTTTCAACTCTATAGATGAGAGTCTGACCCTGCACTG
GCATGGCCTTCATATGAAAGGTTGGCCTTCTTCTTGTTTTAGTTGCTCTGGTCTTCTTGTCTGGCTCACTCTCTTGTCTC
TGGTTAGGGGCAAATCATATGGATGGTCCCGACGGGTTCAATCAGTGTCCTATTCCCCCGGGAGGAAAGTTTGTCTATGA
GATTCCAACGGACAGCCAGTCGGGAACATTTTGGTAAGAGCCGAATCTGAGAATTACGTCGTTTTCTGTCTTCTAAACTG
CTATAGGTACCATGCGCATTCGGAACTACAGCGAGCCGATGGATTGTATGGAGGTTTCATCATACACAATCCCTACAAGG
CAGAAGCGTCGACATATCAGTACGACCAGGAACTTCTGTTCTTGATCGGCGACTGGTATCATTTCGTCGGCAAGGAAATT
TTTGCTGTTTTCAAGGATCCGACCAGCAACGGCGACGAGCCTTGCCCCAGCTCTTTTCTCATCAACGGTCGCGGCTACTT
TGATTGCTCCAACGTTGTTCCTGCAGCACCGGTGAACTGCTCCGAGACGCAGATGCCATCTATCGTCCTTGACAAGAAGC
TTCGTTACAGATTTAGGCTCATCAATGTTGGGTATGTACAATCTTTCGCTTGTCATTGTCTGATTGGTTGGCGCTGATCC
CCCAGCTCTCTGAGTGGTATATCGACAACGGTATCAGATGGGACAATGAAAGCAATCCAGATAGATGGCGGCCTTCCTGT
GGTCTCGCACGAAGCCAACTCGATAGGCGTTCTCTACCCGGCACAAAGAGTGGACTTCATCTTGTCGTGGCCCGAATCTG
CTGCGCAGACGGACACGGAGCTTATGATCACCGTGGACGACGAGTACGTGCACAGATTTGATGGCCACTGGGGGCTATTT
ACAGAAAGAGACTAACGAAAACTAAAGGTACTACGTTCTCAGCATGTTAGATCCCCCGTCTCGATCAGTCCAGATCTCGC
CAGCCTCTTCCACGGGTCGTCCCTCTGAGGAGGTTCCTTCATACGAGAACTCGCCCAGCATCGTCCAATTTGATCTCCGG
GAAGCTCATGGGCCCGTGTTGACTTCATCGTTGCCGGACCCGGATAATCTCTACATGATCTACTCGGTGGTAGAGATTTT
GTCCCACAACAAATATATCCCAAAGGGCTACATCAACCACACAAGCTGGATCCCACAAAAAAAGCCACTGCTTAGCACAG
TTCGAAGTGAGTGGGACAACCACCAGCTTGTTCCCTGGACTGGAAGCAAGCCCGTATGGGTGGAGTTGACGATCAACAAC
ATCGACACCCAAGGCCACTCATTCCATCTTGTAAGCCAGGCCTTGGCGACTTTGGGAGTTGCACAATGTGCTAACAAGCA
ATTCCTAGCACGGCTTCGACTTCTATGTTATCGCCTCCTATGAAGGACTGGGCGGTTGGGATTATTATAATCCCTTTACA
CCCTGGACGCTTCCCCGCGGAGGACCTTTCAATGTCGTAGACCCCCTTCAGAGAGATACGATATACGTACCCCCATATGG
TTATGCTGTCCTCAGATTCTTGGCAGACAATGAAGGGATATGGCTTCTGCACTGCCACATCTTATGGCACGCAGCCAGTG
GCATGACCATGGCATTCCAGGTTCTCGGTGACGAGATTGGTCTCAGCCAAAGTAGTGCAGGACTCGCCGCCAAAGAGTAT
TGCGAGGCGAGCAGTATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62