GenePrediction:GLEAN_3544 Details

Name: GLEAN_3544
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:758335..760657 (+ strand)
Length: 2323
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:758335..758780 (+ strand)
Length: 446
Type: CDS
Source: GLEAN
Position: GCSC_156:758910..760026 (+ strand)
Length: 1117
Type: CDS
Source: GLEAN
Position: GCSC_156:760091..760657 (+ strand)
Length: 567
>GLEAN_3544 class=GenePrediction position=GCSC_156:758335..760657 (+ strand)
ATGTCCGCTCCTCGAACATCTTTCCTCCATCCCGATTCGGCAGACCGCCATGGCCCGTCCAGTCCTGGCTCCTCGTCGAT
GTCGGCTAACAACGACGGCAACGACCCCTATGCGCCAAAGCCCACCTACGCGACCTTTTCCCCCGTAGCCGCCCTGTCTG
GAGCCTCGACAGCTTCTTCAGCAGCGAAACGGCGCAGCGTCATCCTCGTCCACCAAAAGTCGCCGTTACTGCTTGCGACA
CCTCCACAGATCACTCGTGCGCTCGCCTACAGCCACCCATACCTGCTGCCCCTCAACAAGCTTGCCGGACTGCTCAGCTG
GACCACGGGTGATGCCTGGGAGAGCTTTGTGATGGTGCTTGTCTGGTGGGGGCTTGTGCTGTACGGCGACTCTGTCATCC
GTGCGGCTGGTCCCATACTGCTTGTTCTCACACTGATCGCAGGCATGTACGGCCGGCGCTACAGCCCCCTTTCCAGCAGC
GGCTGGAGCACGGAAGATGCTGCAACTGAAAGCAGCGGAAAAGATAGCAGCAGCAGCAACAGCAGCAACAGCGGAATGCT
TGGTGGTGGCCTCAGCTACTTCTTTTTTGGCTACGGCGCCGGTGGCGCAAACGGCACAGCGTCAAAGACCGGGCGCGATG
CGGCTTCGACCAAGAGCAGATCGAGGGCAAAGAACCAGAGCATCGACAGCTCTGGCGCGAGCACAAAGTCTGCCAGCAAG
GGCAGCCACAGTGGCAGTCTTGCTCCGGCCAACGCTTCTGGACATCAGCGCAATGTCTCGGAGGTTGTCACGCATACGCG
CCACCAAAAGACGCTGGACGAGATTGTGGGGACGCTGAAGGAGTTCACGGCCCGCTGTAACCTGCTGTTGGAGCCGCTGC
TAGAGCTGACAGACTTCCTGTCAACGCAATCCACACCCATCAGCGCAACGACACGACCGGCCCTGACGGTCCTCTTTGTG
CGCATTCTTCTCTGCACACCCATCTGGTTCTCCCTAACGCTGCCACCACTGCGTATTATCACCACTCGACGTACAATTCT
GGTCTTTGGCACGGTCATCTTGACGTGGCACTCGCAGGCCATGCGCGTAAGCCGGACGATACTGTGGCGAAGCGCAACGG
TGAGGAGGGGGGCAGCGTTGGTGACCGGCCTGGAGTTCGATGCGCCTGTAAAGGCGACAAAGGCTCCGTCGTACGTGACC
GCCGGTGGCCCCGATGCGCTTGCCGAGTCAGGAGCGACGCCGGCAGCGGCAGCGGCAGCGGTGCAGTCCAAACTGTCAAG
CACACGACGTCCTCGAGGACCATCGACGCCGCGCGAGTCGGAGCTCACAAAGGCCATTAGGAGGGCCAGGGCGGGTCACG
ACGCGGGCGTGCGGTTCACATTCATCTTGTATGAGAACCAGAGGCGGTGGGTGGGCCTGGGATGGACGACGAGTCTGTTT
ACATACGAGCGGCCGTCTTGGACAGACGAGCACAACAATGCAGTGCCTTCCAAGGACGACTTTGAGCTGCCCGAGGTGGA
GGACGGCAGCAAGATGTGCTGGCGATGGGTGGAGGGCAGTCGGTGGCGTGTTGATGGGGTCGTCGATGACGCGGTGCGGA
TCGAGAAAACCGGGGCGTTTGGCGAGCACACCGACACGTGGGACTACGACGGTGATGGTGGACGGATGGGATGGGTGTAC
TACGACAACAAGGTGAGAGGGGAAATCTGCTGCGGACGAACGTGATGCTCTGGAGACAGACGACTGACATTTGCAGTGGC
AAAACGGGCGGCGAGGCCAAGACAGCTGGAACCGATGGACGCGCCGGCGGAAGTGGTATCGGGATGCCGAGCTCGTCGAG
GTGGACGCCGAGGATTCGCTCACGCCCGACAGTGAGGCCAACATGTCGACGCCGACACTGTCGTCGCAGCAGTCGACACC
ACAAGCGCGGGGGTCGTCGCCGGCACCGTCACATTCGGGAATTGCGACGGCCTGGATGGGTGCTAACGGTACTCTGGAAA
AGCGGAAGAGCGGTGACAGCAGCGGCGACCATGACGAAGTGGACACCGATGCCATATCGCTGATGTCGACGTCATCGAGG
TCCGGGCGCAAGAGGCCGTCTCTGCGACGGCGGGTAACGGATGCCAGCGTGCGGGGTTCGGCGGCACCCACGGTAACGAC
GACGGCCACGGCGATGGCCATGTCGACTAACGCAAGGCGGGACGGCGACGGTATGGGCGAAGAGGACGCGGCAATGCTGA
GCTCCAGCGCCGGGGTGAAGCTGCATGAGCCTCGGGTGGGGAGCTGGGGCATCGGTGACGAGGCCCAGATGAGCTTGGAA
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62