GenePrediction:GLEAN_3545 Details

Name: GLEAN_3545
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:761262..763646 (+ strand)
Length: 2385
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:761262..761866 (+ strand)
Length: 605
Type: CDS
Source: GLEAN
Position: GCSC_156:761988..762183 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_156:762252..763646 (+ strand)
Length: 1395
>GLEAN_3545 class=GenePrediction position=GCSC_156:761262..763646 (+ strand)
ATGGACGCCAATGCTGCCACGACACTCGACTATGGCGGCGAGAGCAGCAGCAGCATGCGGGAAGACGACGACGACGACAT
ACGCATGGGCGCGCGACCGGCAATAGGCCGCAGCCACGGGGGCTACGGGGACAGAGAGCGAGACAGGCCGAGCAGCGGCC
GTGCTCGACCGCGTGCCGAAGGAGCCATCCGGCGGGTTCTGCGCTTCTTCCGAGCGCAGTCTGACCGTGGCTACCGCCAG
CTGCGGGATCGCGTGCCGCAGGCGTGTGAGGAGCAGCAGCAGCAACATCAGCAGCAACATCAGCAAAATCAGCAACAGCG
ACAGCTGCACGCGTACGATGACGTGCCAATCTCCTGCATGGAGTCCTTCCGCGAGATGATTCTGTCCTCGTGGCTCAACC
TGCTGCTCGTCTTCGTGCCCATCGGCATGGTGGCATACCTGACACACATGAACCCCATTGCCGTGTTCACGTCCAACGCG
ATTGCGGTCATCCCGCTGTCGTCGCTGCTGACGGCTGCGACCGAGCGGGTGGCCAGCGATGCCGGCGACGCGGTCGGCGC
CCTGCTGAACATCAGCCTCGGCAACTTGGTCGAGTTGATCCTCTTGTACGTCTTCTGGCTCTGTTTTCCCTCTTTCACGC
TCGTGCTAATGCTGTCTTAGTATGTGAGCCTTCCGGTCAGGCCACCCTCTTTCTTCGTTCCCTACTGACGAGCTCCACCC
CGACAGTGTCGCCCTCGTGAACAATCACATCCGTGTCGTGCAGGCGTCCATTCTGGGCTCGATCCTGGTCAACAGCCTGC
TGATCCTGGGCACGGCTCTCCTGGCCACCGGCTTGAGCGACAATGAGCCGGTCTACAACACGGCCGAGACGCAGCTGCTC
AGCTCGCTGCTTTTCGCCTCCGTCTTTGTCTTTTTGATGCCGGTACGTTTTTTGGCCCCGTTTTGCTTTGGCTCATTGTC
CTGTTTGTTCACCTGCTGACTAAGCGACAGACTGCCTTTGGTTACACTTTCGACCACACAAAGGTGTCCAAGGCGACGCT
CAAGATGAGCCGGGTGTCGTCGCTGATGGTGCTGCTGATCTACCTGCTGTACTTTGTACACGAGCTCAGGGCGCGTCCGG
TCCGGAACACTGACGTCCCGTCCGACTACGATATTGAAAGCGATGGCAATGGTAACGGCATTCCCATGAGCATGACAGAG
ATGCAACCGCCGATGATCGTCGCCAACGGACACGCGATCAGCAACATGAACCAGGCGCGGACGATCCGCTTTGCCGACGA
GGGCTACGAGACGGCCACGACAGCCACGACGGCATCGACGATGACGACGGCATCCGTCCGTGACGTGGCCAACAAGGTCC
TGCCGGTGCTGACGCCATTCAGCCAGATCGAGATGGACCGCTTTGACCTAAACGCAGCTACAGACGCGGCGACCGGTAGC
CACGAGGGCGACCTGGCCTTGGAGGGCCGTGGACGCCCCAACGACGGGGCCGTCTACACCAGCGGACGGACACAAACGTT
TATGCCGCGGTCACGGTCGCGCACCAACTCGCACACGCGGCCACCATCATCGCTGCGCTCGCAGCCGTTCCAGATGCAGA
TGCAGCCGCCACCGCCATCACCGCCGCTGCCACCGCCGTCGCGATCGGGACACACGCGCAACATGTCGATCGAGTCACTG
CAGGTGCGGCCAGGTCGGGCGGCCTCGGTCTCGGGCGTGCCGGTGGGCATGTCGGGGGTGGCAGGTGCATACACCACGAC
GGGCAGCACAGCAGGTGTGCCGGGACATGCTGGGATGGCCGGCTTCGGCGGGCTCGGCGGCCCGGGGTTGATGCGATCGG
GACTGGCGGCGCTGCAGATCATGCGAGAGAGCCGGACAAGCCTGGACAGCAACGACGCGCGGCCGGTGCCGGTGCGGCGT
CCACGTCCGGCGGGCGAGTTCATGATGTCGGTGATAGTGCTGATGGTGGCATCGGGGCTGATGTCGGTCAACGCCGAGTT
TCTCGTGGACACGATCGACGCGGTGACACATCAGGGCCACCTGTCGGAGTCGGTGATCGGGCTGATCATCCTGCCGATCG
TCGGCAACATTGCCGAGTACGTGACGGTGGTGTCGGTGGCGATGCGCGACAAGCTGGACCTGGCCATCTCGGTGGCGATC
GGGTCATCCATCCAGATCGCCCTCTGCGTCACACCGTTGACGGTTGGTGCCGGCTGGATCCTCAACCGCAACCTGTCGCT
CACCTTTAGCTTCTTTGAGATGTCCGCACTGGTCGGCACCGCCCTGCTGGTCGGCCTGCTGGTCTCAAGCGACGGCGACC
GAAAGTTGCGGACATGCGGGCTCAAGGGAGCGCTGATGTGCGCGTGCTACGTGATAATCGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62