GenePrediction:GLEAN_3546 Details

Name: GLEAN_3546
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:769225..770957 (+ strand)
Length: 1733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:769225..769431 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_156:769482..769605 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_156:769657..770033 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_156:770091..770228 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_156:770301..770957 (+ strand)
Length: 657
>GLEAN_3546 class=GenePrediction position=GCSC_156:769225..770957 (+ strand)
ATGGCGGGACACTTTCGCGGCAGCATGCCGGCCGTCAGCACGGCATACCCCCAGCAGCCCCAATTTTCCGGCTTCATGAA
GCCATGCCGGTTCGAGGGTGAGGTCGGCAATCTGGAGATTGAGGGCACGCTGCCGCCCGAGATCAACGGCACCTTTTACC
GGGTCATGCCCGACCCGCAGTTTCCGCCGTACATCCTGGACGACCCGGTACGTGTGTTGGTGTTGGTCCCTGTCCTTGTC
CTTGCTGACGGTGACAGTGGTTCAACGGCGACGGCAACGTCAGCGCCTTCAAATTCCACCACGGAGCAGTCGACTTTAAG
CAGCGCTATGTGCGCACGGAAAAGTTTGTGCGCGAGCGGGAGGCCAAGCGGACGCTTCTGGGTGAGTGACGGTGCCCATG
GCGGCCACGTGTCGGTCTAACTGGGCTCGCAGGCAAGTACCGCAACAAGTACACGGATGCGGTCGACTTCAAGATCCGCA
CGACGGCCAACACCAACATCTTTTACTTTAACAAGATGCTGCTGGCCATCAAGGAGGATGCGCTGCCGTATGCCATGGAT
CCGATCACGCTCGAGACCATTGGCCTGCACGACTTTGACGGCCAGATGCCCAGCCTGACGTACACGGCCCATCCCAAGGT
CGACCCGACGACCAAGGAGATGATCGGGTTCGGCTACGAGGCCCGTGGCGACGGCACGCCCGACGTCTGCTACACCAACG
TCAGCCCAGACGGCAAGGTCACCCAGATTGTCTGGCTGGTGGCGCCGGTCGTGGCCATGATCCACGACTTTGCCGTGACG
AAGAACTGGGTCGGTCTTTGGTGGTTGGTCTTTCTTGTCATGGCTGTCCATGGGCTAACCAGACAGGTCCTCTTTCCCAT
CATCCCGCAGGTCTGCGACCTCGAAGAGATGAAGAAGGGCGGCGAGCACTGGCGGTGGGACTCCAACGTGCCCTTTTACC
TCGGCGTGCTCCCGCGTTATGGTGCGACGGGTGCGGATGTCAAGGTGAGAAGCTTTTTTTTTTTCCTTCTTCTTTTTTCT
TTTTTCTTTTTTCTTTCTTCCCCGCTAACCCCACAGTGGTTCCGCGCACCCAACGCCTTCCCAGGCCACACGACCAACGC
GTACGAGAATGAGGCGGGCGAGATCGTCTTCGACCTCCCGCTGACGGACAAGAACGTCTTCTTCTGGTGGCCCGACGCTC
AGGGCAACGCGCCGGCACCGCAAGACATCCACGCGCGCTACGTACGGTTCACGTTCGACCCCAAGACGGACAACCTGGAC
CTGCCGGAGCCGGAGGTGATCCAGGACTGCGACATGGAGTTCCCGCGCATCGACGACCGGGTCGGCACCCAGCGTCACCG
CCACAGCTTCTTCGATGTCATGGTGCCGTCGGCCGGCACCGACTTTGCGGCCATCATGCCGGTGCTCGGCGGCGGCCACC
CGCTGTACAACTGCATCGGCCACCTGGACCATGAGACCGGCCTGTACGAGACGTACTCACCTGGCCGCACGCACATGGTA
CAAGAGCCCATCTTCGTGCCGCGATCCGACGACGCGCCCGAGGGTGACGGCTTCGTCATCGTGCTCGTCAACAACTACGC
CACCCAGTCGAGCGAGCTGCACGTCGTCGACACCCGGAACTTCTCCAAGGCCCAGGCAATCGTGCGCCTCAACATGCGTC
TGCGCGCCGGCCTGCACGGCAACTGGGTCGATGCGCGGGAGCTGGAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62