GenePrediction:GLEAN_3547 Details

Name: GLEAN_3547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:775983..777466 (+ strand)
Length: 1484
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:775983..776033 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_156:776111..777466 (+ strand)
Length: 1356
>GLEAN_3547 class=GenePrediction position=GCSC_156:775983..777466 (+ strand)
ATGCGGAACGAAGAATTAGCCACGTTGAACGGGCTGCGTCTAGCCGACCAGGTGAGTGTTTGAGTGTGTTTTGCAATACA
ACTCGACATCCGTCGTGTTTGCTCCCCTACCTCTACTAAACAACACAGCCCATCAGATATCCGTCCCGATCGGTCCGCCT
GCTCGAGCGCCTCCAGAAGACGGCCGACCAAGATGGCCAGCTCGCGTCCCGAGCGCTGGTTCCGCTCAACGTGGTCATCG
TCGGTGCCGGTCTCGGTGGCCTAGCGACAGCGGTGGCGCTGGCCCGTCGTGGCCACACGGTGACCATCCTGGAGCAGGCG
CCGGCGCTGGGCGAAGTCGGAGCCGGGATCCAGATCCCGCCCAACTCGGCGCGCCTGCTGCTGTCCTGGGGCATCGGGCC
GTATTTCAAAGGCCGCGTGGTGGAACCAGACAGCATGACGTTCCGGCGCTGGCAGAATGGCGACCCGATCGGCTACACGC
GCCTGGTGCCCGACTTCCCCGACGCCTACGGCGCACCCTACCTGGTGATCCACCGCGCCGACTTCCACAGTGCGCTCTGT
CGCCTGGCCGAGCAGCACGGCGTGCAGATCCTGACGGACAGCCGTGTGGTGGCGTACGATGAGGCCGCGCCGGCAGTGAC
GACGGCTGACGGCCGGACCTTTGCAGCTGACCTGGTCGTCGGCGCCGACGGCGTCAAGTCACTGGCGCGGCCGGTCGTCC
TGGGTGGCACCGACCGGCTGGCCAACAAGACCGGCTTTGCCGTCTACCGGGCGGTCGTGGACACGGCCAAGATCCAGGCC
GACGCCGACACGGCCTGGCTGCTGGAGAAGCCGGGCATCAACATCTGGATCGGTCCCGATCGCCACGTGATGACGTACAG
CATCGCCGGCGGCAACTCGTTCAACATGGTGCTCTCGCACGTCGACCACAGCGACCCGGCCTCGTGGACGCCGGCCGACG
CGGTCGCCGAGATGCGCGGCCAGTTTGCCGGCTGGGACCCGCGCCTCAACAAGGTCATCGCCATGATCGAGAGCACCATC
AAGTGGCCGCTGATGAGCGGCGCCCGCCTGCCTACCTGGATTGCCCCTAGTCGCCGCCTCGTCCTTCTCGGCGATGCTGC
CCACGCCATGGTGCCCTACATGTCGCAGGGTGCCGCCATGGCTGTCGAGGACGGTGCTGCCCTCGCCGAGGTGCTCTCGC
TCGTACCCTCCCGTGATCAGCTGCCCGATGCCCTCGCCGTCTTCGAGCAGGAACGCATGCAGCGCAGCGGCGGCATGCAG
ACCGCCAGCCTCGTCAATGGCCGCCTCTGGCATTTTGCTGATGGACCTGAACAGGAGGCACGTGACCGTGGCTCACGCGC
AGAGGTCGAGGGCCGTCCCTTTCTCGAGAGCACGAATCAGTGGAGCGACCCAGTCACGCAGGTGTGGGCGTACGGTTACG
ACGCCGAGGCAGAGGCACGGGAGCGGTGGAAGGCAAGGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62