GenePrediction:GLEAN_3548 Details

Name: GLEAN_3548
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:779210..782774 (+ strand)
Length: 3565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:779210..779362 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_156:779424..779524 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_156:779576..780715 (+ strand)
Length: 1140
Type: CDS
Source: GLEAN
Position: GCSC_156:780767..781760 (+ strand)
Length: 994
Type: CDS
Source: GLEAN
Position: GCSC_156:782311..782682 (+ strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_156:782730..782774 (+ strand)
Length: 45
>GLEAN_3548 class=GenePrediction position=GCSC_156:779210..782774 (+ strand)
ATGGCCCAGGACTGCGACAGCTCTGTGACCGGTACGACGGCCGCGACAGCCCGGAGCATCGACCTGTCGGAGAGCGCGGA
TGCGCCGACACCGGCAGCCAAGCGACGACGCATAGCCCTGGCCTGTTCGGCCTGTCGGATCCGAAAATCGAGGGTGCGTC
TGACCGGTGCTGACGTGTCTTGTTCTGACCGAGCTGACCGTGCTGACATGGCAGTGTGATGGTGTACGGCCGCGCTGCGA
GCCCTGTCAGCGACTGGGCTTTGAGTGCATCTACGAGCTGCCCGACACGTCAGCGAATCTGGTGGTGCCAAAAGAGTGAG
TTTCTTGCAGGTCGATCTCTGCTTGCCTCCAGCCACTGACCTCCAGCCTCTTTGCCGCCCTCGAGGACCGGGTCCGCCGG
GTGGAGCAGTCGCTCAAGGTGCATGACGAGCGGCTGGCCGTGGTCGAGACGGCCGGTCCGTCATCGTCGTCGTCGTCGGC
CCTGCGACCGGGCATCGGCCATGCGGCCAACGGGATCGTCGTGGACGTGGATGGGATCCAGGACGCGGCGGCGGACCAGA
GCATGACGGACGGGATGGCCGTCTCGTTTGTGGACGAGCAGGACTGCGGCTTCTTCGGGCCGTCGTCCAACATTGCCTTT
ATGCGACACATCTTCCGGGCGATGGCACACAAGACGGTGCCGGACGTGGTGCTGTCGCCCATCGCAGGAACTGTGTCCTC
GTCACGTGCAGGTCCGTACGAGTCTGGCCTGATCAATGTGTCGCAGTCACAGGCGCACAACCTGGCGCTGCAGGCGGCTC
CGGATCCGGCAGCCATGCGGACCAACGTATTGCCGCCCGACGGCGAGACGCAGGCGCTAATCCGGGCCTATTTTGCCAAT
ACTGGCCTGCTCTTCCCCTACATCCACGAGCAGAGCTTCCTGGAGACGTACGAGAGCATGCGCCAGACCGGCTTCCGGGC
CAACGTGCGGCGCACCTGGCTCGGCCTGCTCAACATGGTCCTCGCCATGGCCGTACGGACGGCCGGAGCCGAGCGAGGCG
ATGCCGCACGAAGTGAGACCAACCAAGCCAACACACACGAGCGAAGCGAGGCCAGCAGAGCGGACCTCTTTTGTGATCGT
GCCCGCGAACTCTGCAAGACCCAGACTATGCGCGGCACCACGCTCGAGACGGTCCAGTACCTCCTGCTCACCAGCCAATA
CCTCCAGAGCACCCAAAAATCCGTCCAGACATGGACCACCCACGGCCTCGCCGTCAAGGCTGCCCTCTCCATCGGCCTGC
ACTCACGTGATGCCATGGCCAAGCTGCCGCCCATCGAGCAGCAGACCCGCACCCGCACCTGGTTCGGCTGCGTCCTGCTC
GACCGCAGCCTCAGCATGACCTTTGGCCGTCCGGCCGCCATCCCGGACGAATACGTCCGACTCGACCTGCCCGTCTCGTT
GGCCTGGCGTGGCGGTGCTGCCGATGAGCTTAGCCGCACGAGCACCGCTTTTTATAATGCGACTATGTACGTCTATGCTC
CTCTGTCCGCTCTCGTCTCCTCACTAACGATCCCCAGCCTCCTCTATCGCATCCTCTGGAAGGTCATGGCCACCCTCTAC
GGCCATAACCTCGGCTGCGATTCTGCCCCATCCGAGACCGTCACCATCACCCAGATCTTCCATCTCGAGCAGGAATTGGG
CGATTGGCAAGCTGCCCTCCCTCCTCTGCTGGCCCTCGTCTCGCCGGCCGATCTGGCCGATCTGGCTGACCGACGGGAAA
CCATCCCTGCCGCCAACCCGACCACACCCTCCCCTGCGTCCGATCCCATCGATGACCCCGTCATCCTGCGCTTCCGCGTC
ATCCTCACGCTGCGCCACCTCAACCTGCAGCTGCTTCTGCACCGCCCCATGCTGACGAACTCGCTGAGTGCTGTCGCCCG
TGGCGCCGCGGCTCCGTCTGCCCGCTCCCGCCGTCCCGGCCACCACATGCAGATGAGCTTCAACCTGACCTGCGTCCGTG
TCGCCGAGGACATCATCGACCTGATCCATCTCATCTTCACCCGGCCTGCCGGCCTCGGTCGTCGCCTCACCGGCGCCTGG
TGGTTCACCCTCTACTATACCTTCAACGCCGCGCTCGCCGTCTTTGGTAGCCTCCTGCTGCCCGAGGACGACCCCTCCGT
CGACCCGACCCTGCGCTCCGATCGGCCGGATCGCCCCGATCGCACAGACCGCACAGATCGCGGCGCCCGCTTCCTTGCCA
AGGCCATCGACGCGCTCGTCTGCCTCGACGCCGGCAACACCATCGTCGATCGCTGCGTCGACTACCTCCGCCAGCTCGTC
GGACTCGTCCACAGCTGGGGCTCTGCCTCGTCCCCCCAGACCGCTCTGCTCGCTGGACTGGTTGCCTCCATGGACGCCGC
CCCCGATGGCCACGAGAACGAGCACGCCCACTCTCACTCGTCCGACCTCTTCACCCCTATCCCGCTCTTCGCCCAAACTT
CGTCCGGGCTCGAGGACGAGCTTGAGCTCGGCCACTTCTTCACCTCCGAGTTTCAGCGCTGGTTCGAGCGCGTTCCGCAG
TAGCCCTTGCAGATGTGTACGATAAAGACTGGTGATAGACTAGTATTGGAAAGACGGGAACTGTATAGTTGAGAAAGGAA
TGGACCTTTTGTAATAGCGTACATAGCATACATGCACATAAGCCACAAGACTGAGCGATGAAGATAAGAGCCGCAAACAA
AAGCATGAGTGATACGCCGGTTAAGAGAAAGACGTAGATACATCGCAATTGATGGTACTGTCTAGTCACGTGTGCGCTCA
TAATCACTCAGCTAATGATATTTACTAGCGGTGCTTTTGTTAAGTCACATGGTTTCATGGTGTAGTTGGTTATCACGTCA
GTCTAACACACTGAAGGTCTCCAGTTCGAGCCTGGATGAAATCAATTCATTTTTTTGCTTTTTGCAAAGTCCCATTGGCG
GTCCAAATCTCGGTGGGGCCACAGATCGTCACTTAGGCTCCCGTGTCCTTCACGGCAGGCTTCAAACATACTGTCACCAT
GGCTGTCCAGATCGTGTCCGACCTGCATCTGGAGGCCCCCAAGGCCTACGACATGTTCTAGATTCTGCCCCGAGTACCTG
TCCTGGCCTTGCTGGCCGACATTGGCAACGCCGAGCCACACCAGGCCGACATGGCCGCTTTTCTCGACCGGCAGCTACGC
CAGTTCCAGGCCGTGCTGCTTGTCCCTGGAAACCACGAGGCCTATCATTCGACCTGGCCCCGAACCCTCGCCATCCTGCG
ATCGCTGGAAGAGGGCGTCAAGGTGCGACGCGTCGCTGGCGATGCTGCGTTGGGGGAGTTCGTGGTGCTCGACCGTGACA
TGTACCGCCTTCCTGGCTCCAGCGGTATCGTCGTCCTCGGCTGCAGTCTCTTCTCGTATGTGCCACCCGAGCGTGCCATG
GCCGTCAGTATGGGCATGAACGACTTTTACCAGGTGGGCGACGACTGGTCACGAACCAGAGGGGCTACTACTTTGCGCAG
GCTGCCGGCTACGACAATGATAAGACCCTCTGGGCGGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62