GenePrediction:GLEAN_3551 Details

Name: GLEAN_3551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:809435..811403 (+ strand)
Length: 1969
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:809435..810217 (+ strand)
Length: 783
Type: CDS
Source: GLEAN
Position: GCSC_156:810271..810654 (+ strand)
Length: 384
Type: CDS
Source: GLEAN
Position: GCSC_156:810738..811403 (+ strand)
Length: 666
>GLEAN_3551 class=GenePrediction position=GCSC_156:809435..811403 (+ strand)
ATGTTGCTCACCCTTCCAGTACCAGCAATCCCTTTGCAGGTCGCGCTGCCGGCCGCGGTTGCCGGCCTCGCCTACATCAA
TGCCCGCGCTTCGGTGTGGTACGACCTGTTGATGCTGAACTCTGTCATTCCTGCGGTCATCTCCATGAACATGTCCCGTC
TTACCGGCAAGATCAGCGTCTTCTACCGCATCGAGGAAAGGGCAAAGTCCTCGGCATTCGCAAACCGACCCTTCATCCTC
GTCGACGACTACTCGTACACCTATGCGCAAGTCTACGACCGTGCCCTCCGCTATGGCGTGTGGCTGAAAGAAAAAATGGC
CGTTGGGAAGGGTGACGTGGTAGCAGTGGATTTCATGAACTCAGACACCTTCATCTTCTTATGGCTGGGCCTCTGGTCCA
TTGGCGCCAAGCCGGCCTTTATCAACTACAATCTGCGCGATCAGCCGCTGGTACACTGCATCCAGACCGCCACCACCAAG
TTGATACTCGTCGACTCTGCCGTTGCTGAGGCGTTCACGCCAGAAGTTCGCACCGCCCTGTCCGACAGACGCATCGAGGT
CTTCTCCGAGGCCCTAAAGACCGAGATCTTCGCCACAGACCCGATCCGTTACCCCGACGAGCTGCGCCACGAGGACAAGC
TAGAAGACATGGCCGTCCTCATCTTCACTTCCGGCACGACCGGCCTCCCCAAGGCTGCCGTGGTGTCGTGGTCCAAACTG
ATTGTCGGTGGCAACTTTACGTGGCACTGGACGGGCGCCACCAAGGATGATATATACTATACGGTACGTCGACCGTCAGC
AGAGAATGCCTGCAGTGTCTAATTCCGTGTCATCAGTGCATGCCTCTCTACCACTCCTCCGCCATCCTGTTCTGCTTCTG
CACCATGCTGAATGCCGGCGGCGCCGTGGCCGTCGGCCATCGCTTCTCCAACAAAACGTTCTGGCCCGACGTGCGCAAGT
TCAAGGCAACCATGATCCAGTACGTCGGCGAGACGTGCCGGTATCTCCTTGTGGCACCGCCGCAGATCGACCCTGCGACC
AACGAGAACCTGGACAAGAAGCATTCCGTGCGCCTCGCCCTTGGAAACGGCCTCCGCCCCGACGTGTGGAACCGTTTCAA
GGAGCGCTTCGGTATTGAGACGATTGCCGAGTTCTACGGCGCAACAGAGGGCACGCTGGCCACGTTCAACCTATCCCGAA
ACGACTATTCCATGGGCGCCGTAGGTCGCGTAGTGGTTGGATATACAAACTGCTGATGGGGATCAACGTCACGTATGTAG
CCATGGACTGGGCTACCGAACAGCCATGGCGTGATCCGCGCACTGGATATTGTCGGCGTGCCACTGTGGGCGAGCCGGGC
GAGCTGGTCTTCAAGCTTCCCTCGGACAATATTCACAAGCGCTTCCAGGGATATTACCAGAACGAGAAGGCCACCCAGGC
CAAGGTCATGCGCAACGTCTTCCGCAAGGGCGATGCTTGGTTCCGCACCGGTGACGTTCTGCGTACCAGCGCCGAGGGCA
TGCTCTATTTCCACGACCGCATCGGTGACACGTTCCGGTGGAAGTCGGAGAACGTGTCGACCACGGAGGTGGCGCATGCT
GTCGGCCTTCACCCCGAGGTGGTCGCCGCGAACGTGTACGGCATCGAGGTTCCCTGCCACGACGGGCGCGCCGGCTGTGC
TGCCATCGAGCTCAAGGACGGGCCGACGGCAGAGTTTTTGGACAGCCTCGGCCAACACGTCCAGCAGAGCCTTCCGCGGT
ATGCGCTGCCGCTGTTCCTGCGCGTGGTCCAGGACTCGACCGTGCACACGACCGGAACAAACAAGCAGCAGAAGCACGTT
TTGCGCGAGGAGGGTGTCGATCCGGAAAAGGTCGGTTCGGATCCCATCTTCTGGCTGCAAGACGGGACGTACAAGCCGTT
TGGACGGCAAGAGTGGGAGCTGCTGAAGGGCGCCCAGGTGAAGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62