GenePrediction:GLEAN_3552 Details

Name: GLEAN_3552
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:812365..813099 (+ strand)
Length: 735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:812365..812387 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_156:812451..813099 (+ strand)
Length: 649
>GLEAN_3552 class=GenePrediction position=GCSC_156:812365..813099 (+ strand)
ATGGCCGCCGAGAGAGCTACGCCGTAAGTTTCAATGGAAAGAGATGGAGAAAGGAGGGACAAAAGAACCTGCTGACTCCC
ATCTAGACTGCGCCTGGGCAGCACTGCTCCCAACTTCAAGGCCGACACGACCCAGGGCCCAATCGACTTCCACGAGTTCA
TCGGCGACGAGTGGGTGGTGCTGTTCTCGCACCCCGAGGACTTCACGCCGGTGTGCACGACAGAGCTGGGCGAGTTTGCC
CGGCTGCAGCCCGAGTTCACCAAGCGCGGCGTCAAGCTGATCGGCCTCTCGGCCAACACGCTCGGCAGCCACGAGGACTG
GATCAAGGACATTGACGAGGTCACCGGCTCGCTCGTCGGCTTCCCCATCATCGCCGACAAGGAGCGCAAGGTCGCGTACC
TCTACGACATGCTCGACTACCAGGACACCACCAACGTCGACGCCAAGGGCATCGCTTTTACCATCCGCTCCGTCTTCATC
ATTGACCCCAAGAAGGTCATCCGCACCATCCTGTCGTACCCGGCGTCGACCGGTCGCAACTCGGCCGAGGTCCTGCGCAT
CGTCGACTCGCTCCAGACGGGCGACAAGAACAAGGTGACCACGCCCATCAACTGGGTTCCAGGCGACGACGTCATCGTCC
ACCCGAGCATCAAGACTGAGGACGCCAAGAAGATCTTCCCCGACGTCCGCGTCGTGAAGCCGTACCTGCGCTTCACCACC
CTGCCCAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62