GenePrediction:GLEAN_3553 Details

Name: GLEAN_3553
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:815650..818946 (+ strand)
Length: 3297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:815650..818552 (+ strand)
Length: 2903
Type: CDS
Source: GLEAN
Position: GCSC_156:818616..818946 (+ strand)
Length: 331
>GLEAN_3553 class=GenePrediction position=GCSC_156:815650..818946 (+ strand)
ATGGACCATACTGCAGACCCCTACGAATCAACTGGAGACAGCCCGCAGCTCTCAGACTTTGAAATCGACGAGTCGACTCG
ACACAAGACCACCTCCGATATCTTATCTGGCGTCTACCGTGGCTTCAAGAAGATCACCCCCAGCCGAGACGATCTTGCCA
AGCTTAAAAGACAGGCCTCCCAGTCACGCAGACACACTCCCGAGCCGGAAATTGTCGTCAAGCCTTACTCGCCCATCCTA
TCGAGATCACATAGCAGGCGACGCCTAGCTTCTCAGAAACAACAGCATGCTCGCGATCTGAGCCTGCAGAATAGTCTCGA
GAAGCCATTACCTGATACTCCAACTGACCGGTCTCCGAACGGTCCACTCACCCCCATCGCGTCCCAGGAGCGCTTTGTGT
CTCTGGTCCGCAGCTTCGACTCTCTTCCCCACCTCGTGCCACCTACATACATGGATAGTCGAACGAGCACGATGGACACC
AGCTCGTCCATCGAGCAAGGATACCTCTACGTGACGAATAGCGGCAGCACAAACGTGACACCTCACATTGCCAGCGCCGG
TCCCGATATGAACCAGAGCAATGGCCATAACCACATGTCCGAAGATGGACGGGACAACCTCACCCCCAAGAACAACGCTC
CGCAGTCGGCGTCTCTCTCGCCACAAGCCTCTCAACAGTCGTCACGAAACACGCCGAATACTAACGGCTCCGGTGCAGGA
AACGCGGCTGCAGCGACGCCGAGTGCTGCGTCCTCTGCCCACCTGTCAGGCCTGATGTGCAATGTCCACAGAACGACAGG
CAGAGAGCCGCACGCGCTGGTGGGCGCGACCACTACCATCCTGGGTGACAAGCTCTATGTGTTCGGTGGAAGGATATTGT
CACGTAGTCGGCCGGCATCGCTGACGGCAGACCTCTATGAGCTTGACCTGATCCGCCGCCACTGGACAAAGATTGACGCT
ACAGGCGATGTACCACCGGCCCGGTATTTCCACTCGATGTGTGCATTAGGAGACACGAAGATGGTCTGCTACGGCGGCAT
GTCGCCACAGCAAAGTGCCAACGGCATGTCGCCGCAGGACCAGCAGCAGGATATGAACGTTATGTCGGATATACACATTT
ACGATGTGCCTACGAAGAAGTGGGCCTACGTCAAGGCCGTGGAGCCGCCACAAGGCCGATACGCCCACTGCGCCTGCATT
CTCCCCTCTTCTGCCACGTTCAGCTCTCATCGAGCACCGCTCTCGGCACTGCAGCACAACCCGTCCAGCGGGACGAACGA
AGGCCGTCTCGGCGTCAACATTGACGGCACGGGCGGTGCAGAGATGATCGTCGTGGGCGGTCAGGACGGAGGTAACCACT
ACATTGAGCAGATTAGTGTATTCAACCTACGGAGCCTCAAGTGGACGTCCACAGAGCCGCTCGGCAAGAGCTGTGGTGCC
TACCGCAGTGTTGTAGCGCCACTACCACCAGCGGTCACAGCGCGGATCGGCAGAGCTGGGGCTCCCAGCACGGCGCACAT
TCGCCCGGAGACGGGTGGCATCAGCCAGGAGGCAAGGGAGCCCGGGGCATCGATGCTGATCTACTCCAACTACAACTTTT
TGGACGTCAAGCTGGAGCTGCAGATTCGATCGCCGGACGGCACTCTCACGGAGAAGCCGATGGCGGGCAACTACACCCCT
CCTGGGTTGCGGTTCCCCAACGGCGGCGTGATCGACACGCACTTCGTCGTGAGCGGGACGTATCTGACGAGTTCGAAGCA
GGAGTATGCTCTGTGGGCTTTGGACCTGCGCAATCTGACTTGGTCGCGCATCGATGCGGGCGGCAGCGTGTTCAGCCAGG
GCAGCTGGAACCGCGGCGTGTTGTGGAACCGGCGGAACACGTTTGTGATCTTGGGCAACCGAAAGCGCAGTCTTGTAGAC
GACTACAACCACCGGCGGATCAACTTCACCAACGTGTGCATGGTGGAGCTAGAGGCGTTTGGGTTCTACGACAACCCGCG
CAAGACGACGCCGATGTCTGGGTTCGTGTCTGCGAGCAGCCCGTACACCAGTCCCAGTCTGAGCGTGTCCCGCAAGGCGG
GCTCGACGGGCGGTGGCCGGTTCCACTCGCGGGCAGCGGAAGACCTGGGTGAGAAGGCGCTGGCGATGCGGGAGCTGTCG
GACATGGACATTCTGTGCATTGGCGGGGAGCGGATTCCGGTCAACAGCCGAATTGTGGCGCGCCGGTGGGGACCATACTT
TGTGCAGCTGCTGCGAGAGGGCACCTCAACGCAGGATGGCTCAGACTTAAACGGGATGCGGACGATGCCCATGTCGACGC
TGCGCAACTCGAGCATTACGATCACGCCGTCGAGCCGCAACACGATGGAGAGCACGATGTCGATGGGGTCAGGCATGACG
GGGTCCGGAAGCTCAGTTGGCAGAACGCCCAGCACGCCAGGGACCAGCCTCTCGGGCGGGTCAGGGATTGGCGGGCCATT
CTCGTCGCCCATCGACCCTGCCACGATCAACACGGCGCCGACGCCACGGACGCTGCCGCCCAACAGCCGACCGCGGTGTC
TGTACCTACCACACACGTTCCTGACGGTGCAGGCGCTGCTGCACTTCCTCTACACGAGCTCCCTGCCGGCACCGACAAGC
CCGTTGTGCACTCCACAGATTCTGTGCTCGCTGCTGCAGATCGCACGGCCATACCGCATTGACGGGCTGTTGGAGGCGGT
GGTTGAGCGGCTGCACGCGCTCCTGGACAGCCGGAACGCGGCGGCGGTGTTCAATGCGACGGCCATGGCGGCGGGTGGTG
GCCGCGGCATCGACGGGACGCTGAACCCCAACTTCTTCCTACCGAGCGGACTGGACGCGCTGAACTCGATAGATCCGACG
GGCATGTCGCCTTCGGACGCATCGTCGATTCTGCAGTCGCTGCAAGACCAGCAGCAGCAGCAGCAGCAGCCGCAACGGTC
GGGCAGCCCCGACGTGGGCGGGCAGTCTGGCCGTGCAGCAGGGCTGCGGATCAACACATCGGTGGCGGGCTCGTCGAGTG
GCGGACAGCCGGCGAGCGAAGACCTGAGCGCGACGACAAGCATGTCAGGCTCGGAGTGGAGCTCCGAGCTGGGAGACAAC
AGTGAGCGCGGGCAGCGCGAGGTATGGGGCGGCGAGCTGAGCAGCGTGATTGGGCTGCAGAAGCGCGGCCTCAAGGGCTT
GATGGAAGGCCGCCGGCTTCGGGAACGGACGGGCACCAACACAATGGTGGCAAGCAACTCTCGGGTGGGCCTTGGTATTG
CCAGTGGAGGAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62