GenePrediction:GLEAN_3554 Details

Name: GLEAN_3554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:823352..825515 (+ strand)
Length: 2164
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:823352..823435 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_156:823528..823708 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_156:823835..824124 (+ strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_156:824178..825515 (+ strand)
Length: 1338
>GLEAN_3554 class=GenePrediction position=GCSC_156:823352..825515 (+ strand)
ATGTCGTATCTCGCCCAGCCAGCTGTCAGCCGTGGTGACGTCAAGTCCGCGCAGCACGGCGTCGTCGCCCTCGACGAAAC
CGTTGTAGGCGGCCACGCGGCCGAACGCGCGATTGCGGCTCGACACCTCCGGGTGGCCGCGCTTGCAGCCGCGATCGTGG
CCGCGACACGCTCCAGATAGGCCGTCGTGTCAGGGAAGTGGGCCAGGATGCCGTTTTGCAGATCGAGCACGAAGAGGGCT
GTACTGGTCATGGCAGGCATATGTGCGTATGGGCTCCGGATGCAGGATGCAAGATGTCGACCGGCACGAATGGAGGAGCT
GACCCGGATGAGTCTTATAAGAGTCTGCACCGGAGTTGTAAGTCCGAAAAGGGTTGCCGATTCGGCACCGAGACGCCGGA
CTAAAAACAAACGACGGCCTATATGAAAACATGTGTTCTTGGCTTCATCTCGCGCGTGTTCCAGTGAATGGATAGATTTG
CAGGGCTTGCCATGGCCGGAGATGACTCGTTGATGGAAAAGGGCGCGGCTGCAGAGCCTGTGTCGGCTCGAGAAGGCCCA
ACGACCGAAGCTGCAGAAGCGCGAGAAAACGTCGAGCCGTCGCCTCATTCAGTCTTTCCGCCGTGGCAGCGGGCCGCCTG
CGTGTACATGGCCTCTCTGGCAGCTTTCACGTCGCCGGTCTCGTCCAGCATTTACTACCCGGCCATGCAGACGATTGCCG
CCGACCTGCACGTGTCCCTGACCAAGATCAGTCTGAGCATCACGACGTATATGGTGATTTTGTCCTCTTTCTTTCTCTCT
TTCTCTCTCTCACTGACTGCCTGTAGATCCTCCAGGGTGTTGCTCCCACGCTCACCGGCGGCTTCTCGGACCGTGTTGGC
CGTCGCCCGGCCTACATGCTCTGCTTCGGCCTCTTCATCGCCGCCAACATCGGCCTTGCTCGCCAGACCGACTACGCCGC
CCTCCTGGTGCTGCGCGCCCTGCAGAGCGCCGGCAGCAGCGGCACGGTCGCGCTGTCGAGTGCCACGGTCGCCGATGTCG
CCACGCGCCAGCAGCGCGGCCGCTACATCGGCCTGGCCGCGCTGGGCAGCTCCATGGGCCCGGCTCTGGGCCCGCTGATC
GGTGGTCTGCTCGACCATTTTCTCGGCTGGCGCGCCATCTTCTGGTTCCTGGCCGTGCTCGGCGGCGTCCTGCTGCTGGC
CATCTTGACCTGCATGCCTGAGACCTGTCGCAACGTCGTCGGCAATGGCGCCGTGCCGCCGCAGCCCTGGAACCGGCCCC
TGCTTGTTGTGCTGCGGGATCACCGCCGCAAACGAAGCATGATGACTAAGCAAGAACCCACACCCACCATCGCCAGCCTC
GCCCACAAGAAGCGTCCCGGTCTGCTGTCGACGATCCCGATCCTACTCGACCGCGAGTCTCTCCTGACGCTCTTCTACAG
CGGCCTGCTCTACGCCGGCTACTACGTCATCCTCACCGGTCTGCCCCGCCAGCTCGCCGCCACGTATCACTACAACTCCA
TCCAGGTCGGCCTCTGCTATCTGCCGCTCGGCCTCGGCCCCATGCTCTGTCGGCCATTCATCGGCCGCCTCATGGACGCC
AACTTTCGGCGCCATGCCCGCGCTGCTGGCGTCGACTCCTTCGCTGATGACCGCCAGCTCAGCATCGACAATATCCCCGT
CGAACTGGCCCGCCTGCAGCTGTCTCTCGTCGTCGTCTACGGCCTCTGTGCCGTCATCATCCCCTACGGGTGGGTCATGA
ACCTCAGACACCCGCCGCTGGCCGCCGTCCTCGTACTGCTCTTCATCGTAGGCGTTCTCCTCTCGGCCGCCTTCCAGCCC
CTCACCGCTCTCATCGTCGACATCAACCCCCGCAGCCCGGCCGCTGCCACGGCTGCTCATCAGTTTGTCCGCTGTCTGCT
CGGTGCCGCCGGCGTCGCTACCGTCAATCCCATGCTCGACAGCCTCGGCCGTGGCTGGACTACCACCCTAATTGCCCTGC
TCTGGGCCGTCATGAGCGTCTGCTGGTGGATCGTCATCCTCAAGGGGCCGAAATGGCGCAGGGAAAAGAAAGAGAAGAAG
GAGAGGGAGGCCGAGGAAGCTGCCAAAGTCGCTTCATCCAGTCGGTTGCAGGCAATCAGACCCTCTAGACCTCTAGACCT
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62