GenePrediction:GLEAN_3555 Details

Name: GLEAN_3555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:826767..830062 (+ strand)
Length: 3296
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:826767..827100 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_156:827520..827785 (+ strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_156:827843..830062 (+ strand)
Length: 2220
>GLEAN_3555 class=GenePrediction position=GCSC_156:826767..830062 (+ strand)
ATGTTTGTTTCGTGGCGATGCACCTTTGACCGACGGCTCGACAACTCGACATCCGGCAAGGCGGAGCGAGGACGACGCGA
CAACAGCCCACAAACGCGGCTCTGCCCCAACAACATTGCGAATCGGAGTCGGCGTTCGTTCGGGGAAATCGCATCTGCAC
AGGTTTTTGTGGACTCCCTGGTAAGCTATTCACGGTTATGCACGTCTGCGATGCCCCTGGCGTCCACTCTGCCCAACAGC
ATGGCCAGCCTTCTTGCAGCGACCGGGTGCGTGCGAGGCCCGCCGTTCGAGGGCCGTGCCCGCAGGCCTGTCACGGTGGC
GAGCGGTGTGAGCGGTGAGTGGTCAGGAGTTCCGGTGAGCCGCCACACAGTTGTGATCACATGCACAAATCTCGGTTCGT
CACATGCCACAGTGCACCGCCACCTGTGGCCGTGTAAGCCAGAGCGAGTCCGGGGTAAAGTACGGGGAAGCTGGTCACGA
TGGCCCCTACATCTACTATGTATCTTACGAGATCCCCCGTACAGCCTATTTTTCCCTCTTTGTCGGAATGCCCAGCACGC
AGACACGTGCGCTTAGTCGTTTTGGCCACCCCGCACTCTCTCAACACTTGGGTGAGACAGGTCAGCAGTCACAATGGGTC
CGGGACGTATGGCCTTTCCTTTTTAGATCCATGACGTCGCCCTTCCTCTTCATCGACCTCATCTACGTTACGATTCAGAC
AAGCGACAGAAACAGACGTTCACATACGTGCAGACCCATTCACCCTCTCTCTCCCGATGGACGACGTGCTTTTGCCGCCC
ACTGAGGGCAGACATGGGGCTTCCAAGGGAGTCCAGCGGCCGGATCAGAGAGATTCTCACTTGTCGGTACCACCAGCGGG
CTTCGGCGAGCGGCTTTCTTCTGTTGCCAGCCAACTGTCCGGCATGCTACCGTTTGGCCATGCTCAAAGCAGGGCAGAAC
GGCGGCTGCTTCAGCTGAAGAATGAGCAGCGGCAGCTTCTCCAGCAACGCATAGAGAGTGTGAGTGTGGATGTTTCCCGC
CATGAAGAAAGATAATCTCTGCTGACTTGATGGTAGGCTGAGACGTACGAGGAGTGGGAGGCAGCAGCACGGCAACTGGA
CAAGCTGGAGCAGCACGACGCGTGGAAAAGACGCGACAACGACAGCGACATTAGCAGCGACAGCGAGGAGCTGTACAACC
CGCAGGTGGTGGCAGCACGGCTGCAGGAGCTGGAGACGGCGCTGGCATCGGGGGACATGCGGCAGATGCTGCACTTGGTG
CGGACGGCGCTCTCGCGCAATGTGGGAGGGATCAGCAGCGGGGGGCTGTACCGACAGGCAAACACGGGGACAAAGCAGCT
GGTGGAGCGATACGTGCAAGCATCGGTGGCGCTGGTGGAGGCGGTGGCAGAGCGCAGCCGCAGCGCCAAGGGCGGACTTC
CGGCAGGGCTGACACACGGGGCGATGCTGGAGCAGCTGCTGCTGGCGCGAACGAGTTACGGACGCAGCGCGCTGGTGCTG
AGCGGCGGGTCGGTGTACGGGATGGCACACATTGGAGTGCTCAAGGCGCTGTTTGAGCGGCGACTGCTGCCACGGATCAT
CTCAGGGACTTCGGCAGGGTCGATTGTGGCAGCAGTGGTGTGCACGCGGACAGACGAGGAGATGCCAGGGATGCTGAGCG
CGTTTGCACAAGGCGACCTGGCCGTGTTCACAGACAAAGACCATCCGGACTCATGGCTGACGCATATTGGACGGGTGCTG
CGATTTGGGACGTGGCACGACAGCCGACACCTGTCGCGGGTAATGCGCGGGATCCTGGGCGACATGACGTTCCAGGAGGC
CTTTAATCGGACGCGGCGGATCCTCAACATCACGGTGTCATCGCGGCCAGGACTACAGCTGCCATCGCTGCTCAACTACC
TGACGGCACCGGACGTGATGGTATGGTCGGCGGTGGTGGCATCGTGCTCAATCCCGGGTGTGTTTGACCCTCGGCCTCTG
CTGGTGCGCGACGGCGACTCGGGCGAGCACGTGCCATGGGATCCGGCCGAGCAGTTGTGGATTGACGGGTCGCTGGACAA
TGACGTGCCGGTCGAGCGGCTGGGCGAGATGCTCAACGTCAACCACTTTATCGTGTCGCAGACGAACCCGCACATTGTCC
TGCTGGTGGACCGGGAGGGGAGACGACGACGAGACGTGGCGTCGGCATATGCGCCGGTGCGGTCGTCGGTCGGCCGGCTG
CTGCACACGGCCGGCTGGCTGGGCAAGTCAGAGGCGATATACTGTCTAGAGTCGCTGGTCGACCTCGGCGTCTTCCGCGA
CAGCCTGAGCATGGCGGTGCAGATGCTGAGCCAAAAGTACACGGCCGACATCAACATCCTGCCGCGCATGAGCCTTGCGT
GGGGCAGCCACCTGATCCGCAACCCGACGGCCGAGTTCATGCTGGAGGCCTGTCGGGTGGGCGAGCTGGCGACGTGGCCG
AGCATCTGCCGAATCCAGCAGACGTGTGCGGTGGAGCTGGCGCTGGACCGGGCGGTGTATCAGCTGCGGGAGCGCATTGC
CTTTGGGAGCAGCCAGGTGAATCTGCGGCGGTTTTTTGCCGGGAGCCACCAGCTGCAGGTGAGTGGAAGTGGGAGTGAAG
GGAGCGAGGGAGATCAGAGAGGCCGTGCTTTTGGTCTGCGAAGGAGTCAGTCGGGCGTGGCGCTGATGCACGACGACGTG
GTCGAGGAGTCGGACGAACAGACGACATCTACAGTGGCGCTGCCGCTGCCGAAGCGACGGCGAGGATCGGGGAGCAGCAT
CCAGCTGCTGGCTCGTCGGCGACGCAACCGCCACGAACTCGAGACGATTCTGAGCGAGGACGGAAGACGGGAGTCGTCAG
ATGCGGACCTCGACGAAGTACAGACGAGTCGACACGAAGTACGGCCCTCGCTAGCTGTTCGACGTGGCATTGTAGACATG
TCACTGAGCGGAGGCGGCGAGAGGATGTGCACAGTCGTCCACGATAGTCGACCTGGCCGGCTGGCGCCCTTCCGGCAGAA
CAGTCTGCAGCAGCTGCCGATGCAGTCCAAGACGCCATCACCGAGCGCTTCGCTTGCCCGCAGGAGCTACGGCTTTGGCA
ACATCGGCAACGGTGGCACTGGGCTGACACCACTGACAATGGGCGACAGCTGGGACGGACAGTACTGTGATGTCAGCAGC
AGTCCGGAAACAAATACGGACAAGCAGGACGAGGACTCCGATGACGAAGAAGACGACGACGAGGAAGACGACGACGAGAG
CGAGGTTGATTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62