GenePrediction:GLEAN_3556 Details

Name: GLEAN_3556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:834143..836835 (+ strand)
Length: 2693
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:834143..834179 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_156:834241..834300 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_156:834362..834596 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:834666..836835 (+ strand)
Length: 2170
>GLEAN_3556 class=GenePrediction position=GCSC_156:834143..836835 (+ strand)
ATGTGGCTTCTCGATAATGTCGGGCACACCTTTCAGGGTAGGTTCTACGTCTGAACGAATACACTGCACACTGCAACTCC
TTCTGACGCTCTTCACAGGTCGACGGCTATGGCTGCGGCCCGGAAAACGGTATCTCTTTGGTCGGACCAAAGCAGAGCGT
GCGTTCTTCCCCAATCACCTGGCAAGACGGCAGAGCTGACACTAGTCTACGGAGTATAGCTGGTCAGCTGGTCATATCCG
ACAAGACGATCTCCCGGAAGCACCTGACAATCGAGGTTGGCCGTGTGACCGAAGGCGATGGGACCAACCGAGAGAGTCGG
TCCGTGATCACGATCGAGGACCTCAACACCAAGATCGGCACCGTCGTCAACGGCACCCAAATACGGGGACAGAGGCTCGT
CCTGAGCCAGGTCTCGAACGAGGTCAAGATGGGGCACATGGCCGATCTGTTCCGGTGTGTGCGAGCAGCTGCTAGCTAGC
TAGTCAATGCTTGTCTGCTCAGAAGCTGACCAGACGTCTGTAGGATCACGTGGCACCCGGTCGTGCTGAGTTTCTCGCTC
ACGACTAAGGAGCTTCGTGCCGACCCGTGGGCCCTTCTGCGTGAACAGCTCGAGCAGCTCGACATCAAATATATTGCCGA
GTACGATATCGCCCGCACGACCCACGTCGTGGCCAAGAAGCGTAACACGTCCAAGGGCCTGCAGGCCCTCATCAACGGCA
AGTACATTGTCATGGAGAGCTTCCTCTCGGCCATCGAGGCGGCTGCAGGCTCTAGCGCCCTCGAGCAGGATTTCGACGGC
AGCTGGCCCGACGCTCTCGAGTTCCTGCCACCGCGCGGCGACGAGCCGAGCGATCGTCCCGTCAGCACATACAATCCGGA
CGAGCGGCGGAAGGACATCTTTGACGGCTACACGTTTATTTTTTACGACCAGAAGCAGTACGACAACCTGTTTCCGCCCA
TCTCCAACGGCAAGGGAAAGGCCTTGCTGGCCGAGGTCATCCCCGGTGAGACACAGGTGGACAATTTCATATGCTACGTC
AAGCGAATAGCTGGCGACCAGAGCCTGGGCGAGTTCGAGGACGGGGGCGAGGGCAAGGGGGTCGTGGTTGTGCGCTACTT
GCCGGCAAAGGGCGATCATGTGGAGTGGTTTGGCCGGTTTGGCAACGCCGTATCCTTGCGGCTCGACCACCGCCTCATTG
ACCAGCGTGAGTTTCTGGATGCGATCCTGGCCGTCGAGCCGGGCATGTTGAGGCGGTCTCTGCAGGAGGACTCGGGAACT
CCGATTGTCATCTCGGGCTCTGCCGATGAGTCGACACAAATGAGCGCTGGAACGGCACCAGTAGCCGACATGACCGTACC
GGCTGTCGCGCTGCCCACCAGGCGAGGGCGAGCAAGGCGAGGCCTGACAAGCCGATTCAAGGGATTCGATGCCGACCTGG
ATGTGGAAAATGATCCGAATGCGTTCCCACTGGCAGCGGAGTCGATGCAAGCGAGCGAAGAAGGCATGTTCATGTCTCAG
ACATCGGCATTCCAGGAGCCAGAGCCGAGCGTAGCAAGGAAGCGGCCAGTCGCGGCAGTGGCGGAGGAAGGGGAAGACAT
CATGGGAGACATAGCGCCGACGGCAGCAGCAGTCAAGCGGCGGCGTATTGCGGCCGGTATAGAACCTGTTCCGCCGCGAC
AGTGTCTCGAATCAGAAGCAGCAGACGAAGGCGGGACTGCAAATGGCGAGGGCCCAGCAGGCAGCAACAAGGATGGCAGG
GGCAAGGGAAAGAAGGCGGAGGACAACGCAATCCTGAATCAGGCACGCAAGAACCGAGAGGCGGCAGAGAAGCGGGCGGC
CGAAGAGCGCGAGAGGCTAGCACAGATCCAGTCGGATGGCATTGACGCAGAGGAGATCCGACGGCTGACGATCGTGGAAG
AGATATCTGTGCGCGGGCCAACAGGGCTGAGAACGAGAGAGCAAGACGTTGCGGACGGGCGATGGGATCCGCACTGGAAC
GGGCGACGCAACTTCAAAAAGTTCCGCAAGCAAGGCGACGCGGCAGGCCGACCGATCCAGCGGGTGATTGTAGGGCTGGA
GGCGGTCAAGACGAAGGAGTATGGTATTGGGGACGACTACTGGCTGGAAGGCGAAAACAACAGTTCCTGGAGGAGAGGAC
CAGTGGGGCAGCACTCAACCGGCGGGTACAGCTCTATCGAAGTAGACTCGACGGTGACATCGACGGTGCTGGGAGCCCGA
GAAGGACGACATGTGCTGTCGACGGCGACGGAAAGCAGCATCGGCTTGAGCAGCGTCGGGCCGGCAGACGGAGTGGCTGA
CGTGGAGGTGATCCTGGACACGGAGCCGGAAATGGACTCAATGGACACGATGGCACTAGAGGCCGATCTGCCCCGAACAA
GGGCCGGTAAGGTGGCGCAGAAGACGGCGACGCGGCAGAGGCAGGCGGACGTGCAAGCATCGCTGGACACACAGACGCAG
CTGGACGTGCAGCTGCAGTTGGCAGACGCGACACAGACGCAGACACAGAGCGCATCGACACGGGGAAAGCGGACAGCGTC
GGTGGCAGCGAGCGGGCCACGGGCAGCACCGGCGAAGAAGCCGAGGCGGGGAGCAGCAGGCGCCATGACGATCCAAGATA
GCGACAGCGACTCGGATGACGGGCTGCAGTTCAAGTTCCGGAGCAGACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62