GenePrediction:GLEAN_3558 Details

Name: GLEAN_3558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:847880..849454 (+ strand)
Length: 1575
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:847880..847947 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_156:848012..849071 (+ strand)
Length: 1060
Type: CDS
Source: GLEAN
Position: GCSC_156:849143..849295 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_156:849350..849454 (+ strand)
Length: 105
>GLEAN_3558 class=GenePrediction position=GCSC_156:847880..849454 (+ strand)
ATGCCTACCACACGCCAGACTCTGTACCTTCTTTGCCACCCCGAAGAGCTGCGAGCGGTACTTCAATGGTATGGTCCTCC
CTCTCGCTGCCACTTTGAAACATGTTCAAGCTTTTGCTGACCCTATGCATAGGAAAGTGTGGCATGAGCCTGTCCACCGC
CGCGACGCAAGCAAGGAAACGCCAACCGAGAAGGCATGCTTCCAGCACCTTGTGCTGACATCGCGCAGCTTTGCGGCAGT
CATCCAGGAGCTGACGCCGGAGCTGCTCATGTCCGTGTGTCTGTTCTACCTGGTGCTGCGCGGCCTCGATACGATTGAGG
ACGACATGACTATCCCGCTGGAGAAGAAGGTGCCGCTGCTGCGGGGTTTTGACGACCTCATGGAGCAGGACGGCTGGACG
TTTACGGAGAACGGGCCGAACGAGAAGGACCGTGAGCTGCTCGTGCACTTTGACGACGTCGTCACTGAGCTGAAGCGGCT
CAATCCGGCCTACTATGCCATTATCCGTGACATCACGACCAAGATGGGCAACGGCATGGCCGACTACGCTCTGAACGCGG
AGCAGAGCGTGAACGGCATCGCCACGATTGCCGAGTACGAGCTATACTGCCACTACGTGGCCGGCCTGGTGGGCGAGGGC
TTGACGCGGCTCTTTGTGGAGTCGAAGCTGGCCAATCCGCAGCTGATGAATCGGCCGCAGCTGACCGAGTCGATGGGCCA
GTTTCTGCAAAAGACAAACATCATTCGCGACATCCACGAGGATTTCGAGGACGGGCGCCGCTTCTGGCCCAAGGACATCT
GGAGCAAGTACGTGGACCGCTTTGACGACCTGTTCGACCCGGCCCACCTCCAGCAGGCGCTGTATTGCCAGTCGGAGATG
GTGCTCAACGCGCTGAAACACGCCGAGGATTGCCTCTTCTACATGGCGGCCATCCGCGAGCAGAGCGTGTTCAACTTTGT
GGCTATCCCGCAGACCATGGCCATTGCCACGCTGGAGCTAGTCTTCCAGAACCCAGACGTGTTCAAGCGGAACGTCAAGA
TCACCAAGGGCACGGCTTGCCGGCTCATGCTAGACTCGACGCAGAACCTGCAGGTGGCCTGCGAGGTCTTCCGGCGCTAT
GCCCGACGCATACACCAAAGGAACGACCCGCGCGACCCCAACTTTGCGTCTATCAGCCTCCAGTGCGGAAAGGTGGGCGA
TGCACTTCCACCCCCAATGCGCACATGTATCGACAGAATGAGACTACTGACACTCGTATCTAGATTGAGCAATTCATCGA
GTCGCTGTACCCAACGCAGGATGTCAAGCAAATTGTGCCGAAGCCGGGCCCAATGGAGGAGCAGATGCGGGCCTCGGACG
CCCTTTTACTTGTGGCCTGCACTTTCGGCATGCTTCTTGTGGTTGGTGGTGTAATGGTACGTCGCCGTGGCACTTGCATG
TACATCCTTCTCGAAGCTGACACGACGCAGATTGGATCGGCTTGGATCCTAGGAACGAACTTTGACAAGATCTCGAACAT
GCTTGGCATTGCCAACCCATCCAATGCAGCAACCCTCGTACACGAGGAGCTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62