GenePrediction:GLEAN_3559 Details

Name: GLEAN_3559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:853368..855345 (+ strand)
Length: 1978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:853368..854931 (+ strand)
Length: 1564
Type: CDS
Source: GLEAN
Position: GCSC_156:855089..855345 (+ strand)
Length: 257
>GLEAN_3559 class=GenePrediction position=GCSC_156:853368..855345 (+ strand)
ATGGACTCTCGTCTGGAGGCATCGGAAGCCGAAGCCGATGGCCGCCTCACCGCCCCCTCGCACCTTGTTGACAGTCGCTC
GCTGCGGCCGCCGCGGCTGCCTTCCTCCATCACCGAGCACGATGCCGGTCATGCAGCGGTCGAGCTGGCGTCCATCATGA
CGGTCACGTCCAATCCGGTATCGGCCGGGCCGTCCAGCCCACCGTTGGAGCAGGACCATCGGCCGCAGGACTTTACGCCG
CCAGCGCGGCCCAGCAGCACGCCTTTTCCGCAGCCAGAATACCGCACTGATGACCTGCGGTGTCTGAGCTGTCCGGCCAA
CGATGACGCTGGCACGGCCGTATTGGACGCCACCGATCCCGACGGCTGCAGCCAGACGGCCGACGAGATGGACGTGGACG
TGACCACGCCGGACCTGCAGAGACTGCACCTCGGACCGTCCGAAGCGCCGGCGCCGAGACGACGCTCCGTCTTCCTGCAC
AGCCTACCGATGGAGCTGCAGGGCCTCATTCTCGACCGGGTCTTTGACGGCCGCGTGACGCCGATGACAAAGAGCTCGCC
GGAGAAGCGGCTGACGCGGCTGGCGTGCATCAGCACGGTCTGGCGGGTGCTCATCCAGCAGCGGCTGTACTGCCGGATCA
AGCTCAAGGCGACGAGCGCGACGCTGAGCGAGGCGTTGATCCACTTTGCGCAGCATCCGCACCTCAGCGCGTACGTCAAG
CACGTGGAGCTCTGGTTCCCGGTGTTTCAGCCAAAGCCGAAGCCGCCGGCCGTGTCGGACACGGCGATGCTGCCGATGGT
GACGCACGAGGGCCTGTCGAACGCGTCGTACGTCCTGCCGTCGGACAATTGCTCGCTCGAGGAGGCCTTTTACTTTGTCA
GCTCGACGTTTGCCGATGCCAGCGTGCTGACGCTCGAGGGTGGCGAGCGCAAGAAGGCGCCGCAAGTGCGCCACTTTATG
CCGGGCATTGCACGCAGCGAGACGGATCCGCCACGGACGATGCCAGCGGTCACGACAGTGCGCACGCTCCTGTGCAAGGG
CCAGTGGAACCTGATCCGGTCGGAGGAGGACTTCCACAACATCGCGTCGGCGCTGCCCAACATGACGGAATGGAACGCGT
CCTACAGCAAGCCCAAGTCGAAGAGCTACCTGACGATGGCGTCGATCCTGCCGAACCTGCCGGCCAGCCTGACGAGCCTG
GACGTCTGTCTGGAGAGCGACTACCGCCAGGAGATCTCGTTCCCGCCCTACTTCCTCAAGGTCTCGGACCGTGTCCACTT
CTGCAGCCGTCTGGCCGAGGCCACGCCTTCCCTGCAGCACCTGTCCTATACCGGCCGCGTGTGCCGCTCGTTCTTTGACG
TGGCCGCTCGCCTGGCCGATCCGCGCAGCACGCGGCTGCGGTCCATTGACCTGACGGTCAAGAACTGCTGTCGCCATGTC
AGCCACTGGCAGGAGTCTGGGTCCGGCATCACGGACCTCAATTTCATCCGTGCCTTTGAGGCCCTGGTGCTGTCGGCCGT
CCGGTCTCTGGGACGGCTGTGCAAGCTGGAGCACCTGCGAATCCGTTATGTCGATCTAGGTGGGTTTCTTTTTTCTTTCT
TTTTCTTTCTTTCTTTTCTTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTCTTTTCCTTTTTCTTTTCCTTTTTCTTTTC
CTTTTTCTTTTTGTCCTCCTCTATCCCTACTGACCTGCTAGACTTTCCGGTGCCACCGCTGAATCCGTTCTTCCTCCTGC
ACAACGGCCGTGCCTCGGGCGTGTGGAGCGACACGATTGTGGCGGAGCTCAACCGGGTGCGGCCAGAGAGCCAATGGGAG
GAGCTGTCGGAGACGTTTGGCGAGATGACCGTCAGCAAGGACGGCCGCATGGTGATCAACGCGGAGTTCCCCAAGAAGCC
GGTGGTCTCGCTGAAGCTGAGCAACTACGACTATCTCGCGGCGCTGGCCACGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62