GenePrediction:GLEAN_3560 Details

Name: GLEAN_3560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:857418..858417 (+ strand)
Length: 1000
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:857418..857635 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_156:857769..858417 (+ strand)
Length: 649
>GLEAN_3560 class=GenePrediction position=GCSC_156:857418..858417 (+ strand)
ATGGCTCCAGAAGCAAAACGCCCGCGGCAGGGCGACGGCGGCCGTGGCGAGCCATCTAAGAGACCTGCTCGCTCGGCCAC
ATCTTCTGCCCCGGCCGGCCCACGCACCGCCTACACGCCCATGTTTGAGCGTTTCCGCGACCACATGGACGCTCAGCAGG
ATCGTCGTGAACGTGTCGTCAAGGCATCGCGGGACATTACGGCCCTGAGCAAGAAGATGTATGTCGCCCATGTCGCCCGC
CGGCCGTTCCTGTCGTCCAGCCGCTGACCAGTCTCAGTATCTTTGCCCTGCAGCGGTAAGCACGGCGTGCGGTGGGACTC
GCTCTCAAACGACCATGCTGACCACGAGCAGGGTTCGTCGCATCCATCCGGACCTGCCGGCAGATGTCGACAGGGAGGTG
CAGTCGCGCCTCGCCGAGATCAGCCGCCTGCTCGCCTCGATCGCCCCCGAGTTGCAGGGCATCCACCGTGGTCGCTACGG
CCGCGTGCTCTTCGGCATGGAAGAGCTGATCGAGGCCCTCACATTTGCCTACTATCTGCGCACCCAGTCGCTCCTCAGCC
TGGAGGACGCACAGGCGCAGGTCGCTCAGCTGTGCCGCCACGGCCACGCCGCAGAGGCTGCTAAGGCTGCGGCGCCCGTG
CAGCCCAACGCCCACATCCCCGTCATCGGCCCCGACGGCAACGACTACATCATGGGTGTGTTCGACCTGTCTGGTGAGAT
GATGCGCTTTGCCACCACCACCGCCGCCCTCCGCGGAGAGCTGGCCAGCGACGGCAGCCAGAGTGGCCGCACTATCGTCG
GCGACATGCAGGAGCTGGGCAGCTTCTTTGAAATGCTCCCCCAGCGCCACGACAAGTCGTGGAAGACAAAGATGCAGGTC
ATGCAGACCTCCGTCCAAAAGGTCGAGCGCCTCGGCTACGATCTCCGCGTCCGCGGCAGCGAAAGACCCAAGGGCTGGGT
ACCCGATGCCACCGAAATCGAGCCCCAGTCGCCGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62