GenePrediction:GLEAN_3561 Details

Name: GLEAN_3561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:865935..868702 (+ strand)
Length: 2768
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:865935..867222 (+ strand)
Length: 1288
Type: CDS
Source: GLEAN
Position: GCSC_156:867454..867715 (+ strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_156:867775..868702 (+ strand)
Length: 928
>GLEAN_3561 class=GenePrediction position=GCSC_156:865935..868702 (+ strand)
ATGCTGACATCAGTCTCAGTGCCATCCCCAAGAGCCGTCTTGACGAAGTCGCCGGGCGAGACGAGAGAGCGTCGCCCGAC
CCTCAAACTATCGACCATACTGGAAAAGAAGCCAGAATTCGATGAGCCATTCATGGCCATTAAGCCTCCGCCATGGGATC
GCATCCATGACATTGGATTTTACAGACAATGCGGCGGTCCGGAAAATGTGCGAGACACGCCGTCACGAGTGGATACATTT
GCTCGTTCGATCGACCTACTGCACGCACGGTCTGGCCATCGATACAAGCCGACGAAGGGGAAGCTGCCAGATGGCGGGAG
CATGTTCAGTCCAAGCCGCCTGTTCCAGCTACCTTTGGCTGTCCGCCTCCAGATCTACCGCCACATCATCGGGACTGTTG
GCGCAAACAGCGGCTCTCGGCCGATCCGCTTGAATGCCATGGTGCACAACCGGCTGGCCTGGCCAGAGGATGCTTTCGAC
TCGCTTTCCGACGTTCTCGCGCCTCTCCGAGACATTCTTATCGCGTCTTCAGCCCTGCGCATCGAGCTGCTGGCCGCCCT
CTTCCTCGAACGATCCGTCCACGTGACCTTCTCGCCGTACGTGCGACCAGCGACCTCCCCACTAGCCGTCACCTTTACCA
ACCAGTATGGATGTCTGATGCAGCGAATAACGCTCGAGCTGGACTGCACGCGGCTTGGTTATGGCATGGATGCAGCGGCC
GCTGGGCTCGCGCCGGGTATGCTGCACATGGACAGTCTCGTGCATGGCTTTGTGGCCGGCCAGACAGCACGAGCCGGTTA
CAGTACGATGGAAAGTCTGGTGGTTCTGTGTCGCCGATTCCATGGCAACCGACCGTCGATCGAGGACCAGACAGCTGTGC
CCTACACCGGCCCAGAGTACGAGCAGGTGGCCCAGCAGCTGGCGGGACTGTGTGGCCTCGTGGATTCGGCACGCATCGTC
GGCTTCTCGGCAGCGTTCTCGAACGCTTTAGCTCGACGTCTCCATGGCGAAATGTCTGTCTCACCTACGGAACAGCGACA
GCTTGGCTACATTTGGTGCCGCACACCGTCGGATGCCTACAAACTCCTGCCAGGACACCGAGCTTATCTGGACTATGGAC
CGGGCGTCGGCGTGCGTCTCAGCCCCCGGATATCCCTACCACCATCACCTCCGTCGTCTGTGACTTCGCCGTCGATATTG
ACATCGGTTCTCCCGTTTCGCCCTGCCGCCGACGTCGACATGTCGCCGGCCTCCAGCCGCCCACCATCTCCCGCTTTGTC
GACGCCCAGTAAGCGAACCAGCTTTGTCGTGTCTCTTCTGGACAGGGGCCTCTTGGAAGGAAAGCTGTCAGCCAATAGCA
CATCCGGAGGATCAAAAAGTGTCATCGTGGCAAAGCCAAGAAAGCTGCGGAAGAGGAGGCCAACAAGCGCAGTCTGATCC
TACATATGCACATATGTGGTATATGCATAAAAAAGGGCAACGCTACACTTATTACACCAGCTTCTCCTCATCTCCACAGC
ATCTTACCACTTCTCCTGCCTAAACAACGCAATCATGACGATCCCGTCTTCCCAGGCGCCTTCTCCTGGCTGGAGCAGAC
TCGACTCGTATCCGAAAGTGCCATGGGGGAGGCAGGTTCTGTATGCCTCTGCCGCATACGCCATTTATGGCCTCAACATT
CTGGCCCACCACATCCAGATAATCTGGTACAAGGTTGGGCCGGCCAGGAAAGGCCCAGATGAAGTTCGGTCATATCCGTG
CCGGCCGTCACTGTCTGTACGGTACGTATCTGTTTTTCGGGCGACGAACGCCAGTGTGAAGAGGCTCTGACTGCGTTCAG
TGTCTTCTTCCCGTCTAAACATGTGTCGGCCTCGGCGAAACTGCCGACCCTGTTCACTATTCATGGCGGTGGTTTTGTTA
TCGGAAACCCAGAGGACTCGGATGTGTGGAACTATGACTTTGCACACCGCCATTCGATGCTGGTGGTGGCCCTGGACTAT
CGCAAAGCGCCCGTGTGGCCGTTTCCATGTGCCATCCACGACGTCGAGGCGCTCGCCTTGGCCGTGCTGACTGATACGTC
GCTGCCAATAGACGCATCGCGGGTGGCAATGCTAGGCTGGTCGGCCGGCGGCAATCTTGCACTTGCGGTGGCATCTCTGC
CTAGCATGAAGGGCAGCATCGATAATGCCAGTCGCCCACGCATTCACGCTGTGGTTCCCATATATCCCGTGATCGACTTC
AGTGTCCCTAGAGCGTCCAAACTGCGAGCGCGCCAGTACAAACCGTTACCAGGTATGCGTGGCCACAGGACGGACTTGCT
GCGCCCAATGGCACCCGTGTTCGACTGGGCCTATATACGCGGCGTAAAGGACGTGTCCGGGATACTGCGGAATTCGCTTC
TGAGCCCCGCCTACTTGTCGCGCGAGGAGCTGCCGCCGTTTGTTTTCTTCATCGCCTGCGAGCTGGATATGCTCTCCATG
GAGTCCCTACGCAAGGTGAGCCAGCTTGCCGGCCGGCCACAGCCCGACGACGATGCCGTGGTCGGCTGCGGCGAAATTGG
CAAGCCAGATGAACTGATCCTGAATGATGAGCGGTTTTCGTTTGAGACTCGAACGGAGAGCAGCAGCTACCGGTGGCTCC
TCGTCCCTGACTCCACACATGGGTTCGACCAGGCCTTCGCAAACTCCACAGATGCGCTGCAGAAATTGGAGCTGAGCCAG
GCTGTCATTGCGGAATGGCTGCTTTCTGGCCCGTTTGCCGAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62