GenePrediction:GLEAN_3562 Details

Name: GLEAN_3562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:869618..870215 (+ strand)
Length: 598
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:869618..869667 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_156:869747..869774 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_156:869855..869917 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_156:869990..870083 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_156:870160..870215 (+ strand)
Length: 56
>GLEAN_3562 class=GenePrediction position=GCSC_156:869618..870215 (+ strand)
ATGACTGGCCGTGGTGGAGGCGGCGGGCGCCGCGTGTTGCTGCCGCCAATGTGAGTTTTTTTGGCTTCTCCGCCGTTTCG
CCCTTGCTGTCGTGTGAAAGCCGCGTTTGACTGACCGGTGGCGATGCAGCAACATGATCTTCAAGCTTCTGCAGTCTGTA
TGTCTGGTCGCCACCCCCTCCATTCCTCTCGGTCGCCTCTTTTTTCTTGATCGAACCCTGCTAACAGCTCCCTCTAGCAC
GCGACTGTAAGCGTGTGGCTGTACGAGCAGCTGTCCTTTCGGATCGAGGGCAAGATTCGGGTAGGTCATGACGCGTGTTT
CTCTCCGGCTCCCCGCCGCTGCAGCCTGGTCCCAAGTGCTGACACAGAACAGGGCTTTGACGAGTTTCTGAACCTCGTGC
TGGACGACGCGGTGGTGGTTGGCCAAATCACAAAGACGCAAGAGGAAGAGACGCGGAAACCGCTCGGTACGTTGCTGCCG
GTGAAGCTGCTATCCCAACTCTCACACCCGCGCGCCTGCATTCCGTGCTGACATCGAAACAGGCCGCATCTTGCTGAAGG
GCGACAACATCTCGCTCATCCAGGGCGTTTCTTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62