GenePrediction:GLEAN_3564 Details

Name: GLEAN_3564
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:878411..879829 (+ strand)
Length: 1419
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:878411..878475 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_156:878536..878716 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_156:878771..879347 (+ strand)
Length: 577
Type: CDS
Source: GLEAN
Position: GCSC_156:879405..879829 (+ strand)
Length: 425
>GLEAN_3564 class=GenePrediction position=GCSC_156:878411..879829 (+ strand)
ATGGCCGAACGTCTCGGTTCTATCCTCAAGCACCTGTCGCCAGGTGGCAATGCTGTTTCCACCTTGTTCGTCTCGCCCTG
ATCCTCCCGATCCTTTCCTCTCAATTTTCCTGCTGACACTTCCAGAACATCCAAACACCCCGACGACATTGTCATCACGC
TTGCCATCCGCACACCGCTCACCAAAGCTCGCAAGGGCGGCTTCAAGGACTCGTCGCTCGAATACATTGTTTATGCATTG
CTCAAAGAAGTTAGGGAGCGTAGCAAGATTGACCCCGGCCTGGTCGAGGATGTCTGCTTGGGCAACGTAAGCGGTGCTCT
GCTACAGCTGGCCGTCGTCTGCTGACTTTGTCCCCGACAGGTGTCCGATGGGAAGGCAGCATACAAGCTGCGTACCGCCT
CGCTGGCAGCGGGCTTCCCCAACACATCCAGCGCCTCAACGGTGAACCGGTTCTGCTCGTCCGGCCTCAAGGCTACGGCC
GACATTGCAAACGCAATCAGCGCGGGCAACATCGAGATCGGCGTGGCCATCGGGGCTGAGTCCATGTCGGCCGGGGGAGA
TGCGGTGGACCAGCCGTTCGACGAGCTGGTGACGGGCAAGAACCAGGAGGCTGCTGATTGCGTGCAGCCCATGGGCTGGA
CCAGCGAAAACGTCAGCCGCGACTTTGGCATCCCGCGCGAGGAGATGGACCGGTACGCCACCGAGAGCTTCCGTCGCGCC
GAGGAGGCACAAAAGGCCGGACTCTTCGACGACGAGATCGTGCCCATCAAGACACATGTCAAGGATGCCGATGGGGTCTG
GCAAGAGGTCACGCTGACCCGTGATGAGGGCATCCGGCCCGGCACCACGTTCGAGGGACTGTCCAAGGTCCGCGCGGCCT
TTCCGCAATGGGGCCCGACCACGACTGGCGGCAATGCCAGCCAGGTGACAGACGGAGGTGCGTAAAGACAAATTGAGTGG
CAGTGCATGTGCATCCGAGATGCTGACAAATCAGCCGCGGCTGTGCTCCTCATGAAGCGCTCGACAGCTGTTCGCCTGGG
CCAGCCCATTCTGGCAAAGTACGTGGGCAGCACGACAGCCGGTGTACCGCCACGGATCATGGGTGTTGGCCCGACGGCGG
CCATCCCGAAGCTGCTCGCCCAGCACGGCCTGACCCTGGCAGATATCGACGTCGTCGAGGTGAACGAGGCATTTGCCAGC
ATGGCCGTCTACACTCGTGACAAGCTCAGCCTCGACTGGGCCAAGATGAACCCGCGGGGCGGTGCCATTGCGCTTGGCCA
CCCGCTGGGCGCCACAGGAGCGCGCCAGATTGTCACGGGCCTCAGCGAGCTGCGGCGACAAGACAAGAAGGTCCTGCTGA
CCAGCATGTGCATCGGCACGGGCATGGGCATGGCCGGACTGTTTGTCAACGAGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62