GenePrediction:GLEAN_3565 Details

Name: GLEAN_3565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:881389..882362 (+ strand)
Length: 974
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:881389..882165 (+ strand)
Length: 777
Type: CDS
Source: GLEAN
Position: GCSC_156:882226..882273 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_156:882330..882362 (+ strand)
Length: 33
>GLEAN_3565 class=GenePrediction position=GCSC_156:881389..882362 (+ strand)
ATGTATCCCTTCGCTTCTGCCGCCTCCCTGTTCCTGGCCAGTCTGCCAGCTCTCGTGCAGGCATGGGACGCTCCGGCTTA
CTCTGGCTACAGCTTGGTCTGGCAGGAAGCTTTTGCTGGCTATTCCGGCACACTGCCCTCTTCGACTACCTGGAATATCA
TCACGGACATATCAGTCAACGAAGAGGCAGAGACTTACACCACCTCGACCAGCAACCTTCAGCTGTCGGGCGGAAACACC
CTCCAGATCATTCCCATTTGCGATAGCGCCGGCAGCTGGACATCGGGTCGTATCGAGAGCTCATACACGTTTACGCCTGC
TGCCGGTAAAATCACCTTTGCCGAGGCAGACATTCGCTTCGGTGGAAACTCCATTGCCAACAAACAGGGCCTGTGGCCCG
CCTTTTGGATGTTGGGCGATAGTCTTCGCCACGGAACCTCCTGGCCCCAGTCAGGTGAGGTCGACGCCTTGGAAACCGTC
AATGGGCTCCTCACCGGCTATGGTACCTTGCACTGTGGCTCCAACCCCAATGGGCCATGCAACGAGCCCACCGGTGTCCA
AAACTACATCACCTTTTCCGACCAGAGCTGGCACGTATGGCGCGTGAAGTGGGATCGGTCGTCGAACGATTGGGAGTCCG
AATCGATCACCTGGTATATGGACGACCAACAGTATCATATTGTAACCGGCTCTTCGCTGGGAAATGAGGACGACTGGGCT
TCCGTCTGCCATGACCCCTTATACTTTATCCTTAACCTGGCCGTCGGCGGCTCATGGGTAAGTCAAACTTTCGCCGGATC
TCTGACGTGCACTCCTGCTAATCGCTGTGGTTCGCAGCCTGGTGACCCAAACTCGTCTACTAAAGATGGCTACGGCAGCA
TGATGGTATGTTCAACTTCTCAACCAATACACGTATGTGACTCGAGTCTAATCAGAAACAGGAGGTCGCCTACGTCGCCG
TTTACTCAAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62