GenePrediction:GLEAN_3566 Details

Name: GLEAN_3566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:905438..905926 (+ strand)
Length: 489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:905438..905578 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_156:905651..905926 (+ strand)
Length: 276
>GLEAN_3566 class=GenePrediction position=GCSC_156:905438..905926 (+ strand)
ATGGCTTCACCAAAAGTTGAAGACCAGGACGTGCCCGCCGTCGGCCCATCCCTGAATGCCACGGAAAGTCTGAGTCTCAA
GCAGCGAGAGCAAGAGGTTCTCATGGCCGCATGGCTCTCTATCAAGGGAGCTGAACCACAAGTGTGTCGCCTCCAATCGC
AGCTCTGCTCGGCTTATGTACATTCGAAAACTAACAATGTCATCTCACCACAGGTGGACTATGATAGTATGGCCAACATT
CTGGGACTCAAAAACGGCCATACAGCTAGCACTGTGTTCTACAATCTGAAGAAAAAGATGAAGCAGTTCCGCAGCCAGGC
GGGTGGGGCTGGCGAGTTGCCGGCATCCCCCATACACAAAAAACCCTCTACGCCCCGCAAGCGTGCGTCTGGGAATGCAA
ACACTCCCAAGTCGGGCAGATCTGCCAAGCGAGTCAAATTTGAGGCTTCTACTCCACAAACTCCGGATCTGGCTGAGGGC
GAAATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62