GenePrediction:GLEAN_3572 Details

Name: GLEAN_3572
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:927162..930025 (+ strand)
Length: 2864
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:927162..927590 (+ strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_156:927653..929366 (+ strand)
Length: 1714
Type: CDS
Source: GLEAN
Position: GCSC_156:929424..930025 (+ strand)
Length: 602
>GLEAN_3572 class=GenePrediction position=GCSC_156:927162..930025 (+ strand)
ATGGCGTCGTCTACAGTCACGACAGCCTTGCATTCCCACCGCGCATCCTTTTCTGCTGCGGCTCCCCTCTCGCCGTCACC
CGCGCCTCCTCCGTCCCAGCTGCCGCCCGCTCCGTCTGCAACGCTGCCGTCGGTAACGCTGCATGCGCCCGCGGCAACGT
CGACTTCCACATCGACATCACTGCTGCCTCATCCGCCGTCCTCTCAACTCGGCCACGGTGCTGCCGGTCATCCCTCCTTC
GATCACGTAACCGGCAACATCCATATGCCGTCCGCATCGCAACCAGCTCAGCCGTCGTCTCAGCAGTCGTTCGTCATGAA
TCAGCCATCGTCCCAGCCAAATCCCACTCTCTCGGCCTCTGCCTATCACCCGTTCTCGGAGTCGTCCCAGCCCAAGCTGG
AGCATGACGATCCGATGAAGATTTACTCGGTGAGCCGGCCAGCCGTCTTCTTTCCTTCTCTTGCTCCGTTGCTGACCAGG
CCTTCTTCCAGGCCGTGTATTCGGGCACCAACGTCTACGAAATGGACGTGAATGGCATTGCGGTTATGCGTCGGCGCCAC
GACTCGTGGCTCAATGCCACCCAGATACTGAAAGTCGCCGGTGTTGACAAAGGCAAGCGTACCAAGATTCTGGAGAAGGA
GATCCAGACCGGAGAACACGAGAAGATCCAGGGCGGCTACGGCAAATACCAGGGCACGTGGATCGGCTTCGAGCGGGGTG
TCGAGGTGTGCCGGCAGTACGGCGTCGAGGAGATTCTGCGCCCGCTTCTGACGTATGACATGGGCCAGGACGGCGGCATT
GCCGGTCAGGGCAACTTCAACACGCCGACAAAAGAACAGGCCATGGCCGCTCAGCGCAAGCGCATGTACAATGCCAGCAA
CGACAACCGCGCAAACGGTGCATCCGGGACCTTCTTCCGGGGCATCTCCAACACTGCGTCCAATATGGTGGGCATCATAA
GCAAGGCCCGATTCGATTCGCCCGGCCCACGAAACCGAGCTGCCGGCGGACAGGCAGACAGGAGTGGTCTTGCCCGGGCC
CCAAGCTTCACGCGACAGCCATCGATACAGGCCGACGAGCTGCCCAACTCGCAGCAGAGCTTTGCGTCCGACTATGGCCG
CGACAGCGAAACACCCGTATATCTCTCGCAGCAGCAGAGCACGCAGCAGTCCGTTGGCGACGGTGCTGAGCCTCCACGCA
AACGAGCTAGAATGGGCGCCACGTCCGGAGACAGCTTTGCCTTTGCCGGTTCTGCTGACGCCTATGCCAATGCGAGTGCA
TTTCCTGGTTCACCGACGGAACCAAACGAGTCGTTCATCTACAACCAGGCCGGCCTCAACGCTCACCTGGTGGCGTCCAA
TGACGGCCATGTTCCGCTGCCTCCGCTGCCGTTTGAGGTCTCGCCCGACGCCGAGGCCAAGCGCAACACGCTCATGTCCC
TCTTCATGGACGCCAATGGCGACGATCACTCTCGCCACGACACCCTACGCCGCATGACCCCTGGGGAGCTGGACATGCCC
ATCGATGCCCAGAGCCACACCGCGCTGCACTGGGCTGCCACCTTGTCACGCATGCCGCTTCTGCGAGCCTTGATAGCCAG
TGGGGCAAACCCGTTCCGGGTCAACGCCGTCGGTGAGACTGCACTGATGCGGGCATGTCTCGTCACCAACTCCCACGAGC
ACAGCTCCATGCCGGATCTTCTCGACGTGCTCGGCAGTACCATTGAGGTGCGGGACGCCAAGGGTCGAACGGTCCTGCAT
CACATTGCCGTCACCAGCTCGGTCAAGGGCCGGAGTGCCGCCAGCCGATACTATCTGCAATGTCTCCTGGAATGGGTTGT
CCGCCAGGGCAGCGCACCGAACAGCCAAACCATGCAGCCAGGCATGAATGGTAGCGCTCCTTCTGCGCCTGCCAAGCTTG
GCCTGGCACGCTTCATGAGCGAGATTGTGAATGCGCAGGACAAGGCTGGCGACACGGCGCTCAACATTGCAGCCAAGATT
GGCAACCGCAGCATCATCTCCCAGCTCCTAGAGGTATGCGCCGATCCCAACCTGCCGAACCGGCAAGGATTGCGGCCGCT
GGACTTTGGTGTGGGTGCCGACTCTGTGGTCAATGCTACCGGCGGCGAGGCGGCAGACGGCGATCATAGCGGAACCGTTG
GCAGCAGCCAGAAGAGTCGAGAGAGTAGCGACGATATTGTTTCATGTAAGTCATCCTCTGTGTGGATCGCCCCAGCCTCA
GGCAATGCTGACAAATACGCAGCGATAACACACCTCCTCACCGAGACCGCATCGGTCTTTCAGGCCGAGATGAAGGCAAA
GCAACAAGCCGTAGAGGCTCTGCACAGCCAACTGCGCACCACGTCAGCCCAGCTCGGCGATGCCCGGAGAACACTGGACG
CGCTGCAGGAAAAGGTCAAGAACCAGCAGCAAGCCCGCCAGCGGGTTCTCAACCTGTCGCGGGCACGAGATGAGGAACAG
TACCGTCTCGTGGATCTGGAACGGGCACACGGTCGAACCATCGCGGAGCTCGACAGCATGGCAAGCTGGGCGGTCGAACC
GGACGCCTCTGCAGACTCGGCAGATGCCGCAACATTGCCGTCAGCCGCCGTGATGCGAGCTCGAATTCGCGCGCTGCACC
AGCGCACAGCCGAGACACGGCGGGCCGAACAGGCGCTCAAGAGCCGCAGCCGAGACATCGAGCTCAAATTTCGCCGTCTC
GTGGCCTTGGCAACCCGCTGCTCCGACGCCGATGTGGACAGCCATCTGGACGGTCTGATGCGTGCCGTGGAAAGCGAAAA
AGGCGACCTGGAGATCGGACGGGTGCGTCGCTTCTTGGGCGGCGTGGAAGGGCTAGTGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62