GenePrediction:GLEAN_3573 Details

Name: GLEAN_3573
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:933126..935402 (+ strand)
Length: 2277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:933126..933221 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_156:933286..933767 (+ strand)
Length: 482
Type: CDS
Source: GLEAN
Position: GCSC_156:933833..933924 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_156:934378..935402 (+ strand)
Length: 1025
>GLEAN_3573 class=GenePrediction position=GCSC_156:933126..935402 (+ strand)
ATGGGTTCCAAGTTTCCCGAAGTTCAGGGTGGCGGCAGCCTAATGGTTGCTTGGCAGGTAAAAGGCAAGAGAGTTCTTGT
TGTCGGCGGTGGCGAGGTAAAGCGGCCCTCTTTTCGCCCTCCTCTCCCCTCTCTATAGGTTGCTAATTCAACAGCTTTAG
GTTGCAGCTGGTCGCATTCTCCACTGCCTCAATGCCGACGCCACAGTCACTGTCGTCGCGCCAAGCTCGGGGCTCAACCC
CGAGGTAGCCTACCGTGTACACCAGAAGCAGGTTGTCTACATCGATCGCACGTTCGAGCCAGATGATCTCGATGGCGTCG
ACATGGTTCTCACGGCCGTGGACGATCCAGAAGCCTCTACACGAGTATGGAAGCTATGCAAGGAGAGGCGAATTCCCGTC
AATGTAGCCGATGTGCCGCCAGAGTGTGATTTCTACTTTGGCAGCGTCCATCGCGATGGGCCGCTACAAATCATGGTCAG
CACAAACGGTAAGGGCCCACGGCTGGCCCAAACCATCCGGAAGTACATCGCCAAACTGCTACCAAAGGAGGCCGGCAAGG
CCATCAACTCTGTGGGTGAGTTGAGGGTGAAGCTACGCCGGATGGCACCGAACCCAGAGGATGGGCCCAAGAGGATGGCA
TGGTAAGCCCCCTTTCCCATCCAGCTTTCCATCTGTCATTTTCGGGACGTGCACCTGACCACAACAGGATGACCAAAGTC
AGCGATGCCTACTCTTTCGAGGAACTTTGCAGCCTGAACGACGAAGACGTCAACAATCTGTTGCGGTTTTACATGTCAGG
TACAGTGCCGGCTCTCGATATATTGTTCTCTATGCGAGGCAACGGCGACATTGGCAAAATTGATGTATTTGATGGTTCGT
TTGGCTTCAGCGTAGGCGTGTGACCGCTATAGCGTGTGGGAAAGTCGAGTATGGGGTGAACAGACGTTCTAAGTATTCAA
GGCGCCAGTTTGGTTGATTGCCGGCTTTTCGAATACGTATGAACTGTAAGAACACAAAGGATATTTTCCTGCTTTCCTGT
AATGCTAGGCCGCATGCGAGGCCTATGGAGTACTTCCCACTTTACACGTACAGTGTATTTGTCTGGTTATATTTATATGC
ACTGTGTTGTGATATCGATCGCGTATTGGCGGCGCGTACATCCCGGCAACGGGGCGCAGAACAAGACAAAAGACTGCGGC
CAGCTCCATCACAGCATGGCCAGACTGAATGGCAATAATGGTCATGCCATAGGCGTCTCCTCAGGCACTGAGGATGGTTC
CACAGCTGACACCTCACAGCCGCAATGCGACATCTTCAACACAACGTTTTCCTTGTATCGAGCTTCGCCGCTGTTTCTAG
GTCCAGACCCACTCTCATATGCGCGACTTGCGACTCTCAGCCAACGGCTTCGAGATGTGCTTGTGGGCGATTTCGTGCGA
GGCGTGGAGGTTGGCCTCGACAACACATCCGGCGCCTCAATGGGCAGCGCAGGTAGTTTAGAGGGTGTGACGACCGAATG
GGCCGCTTCTGATGATGCTCTGGGTATATCTGATCGAGCTCTTCAGATCACTTTACAGTATGAGAACGCCATCTGCTCCG
CGTTGCTTCTACCGGCACCACCAGCGAACGCTGCTAGAGACGACAGTACCAAGGGTCAATTTTTGCACCTACCCCTTCTT
CTTCTCCGGATGCCCACCCCGTTGAAATCCGCCATCATCTCTTTCATTTCGACCACATTTGACTGCCGGATTGGTCCCTT
GCGCCTGAGCAGCGAATACATGTACCAGAGGTGGGAAGCTTGGGCACAAGGCACAGCACTTCCGACGACTGGTCCTCTAG
CAAAAGACGTCGTTCTCACGCTCGGGTTTCGTCTTCCTGGAGAGCCGAGTGAGACGGCCTTTAGCATAGACGAGGGCGAA
GCACAAAGTGGGACAGTGGTTAATGCCACGTCAGGCCTCAAGGCAGTCGATGTTATTGTTCCCTTTCAGGATCTGCCGCA
ATTTTCCAAGGCCGGTAAAACCTTCACTAAAGGCGGGGACGGGGTCGACAAGCCGCTCACGAGAGCTTTAATTCACTACG
TGAAGCACCACCTTGCCCTAGACATGTCGCATCCGGCCGTCAGTTTGGTGCGCATTGCCTGTGGAGGTTTTGTGCTCGCA
GAAAGCCGCATCAAGATATTCAGCCCGTCTGACGCCATCACAGGCGCTGCACCTCATGCAGCCGCAGTGCAAGAGCTCCT
TTCACAACTCGCAACGAGGGCCGCAACAATAATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62