GenePrediction:GLEAN_3574 Details

Name: GLEAN_3574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:939554..939972 (+ strand)
Length: 419
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:939554..939675 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_156:939765..939972 (+ strand)
Length: 208
>GLEAN_3574 class=GenePrediction position=GCSC_156:939554..939972 (+ strand)
ATGCCTGTGTCAGCTCGTCCGATATTTGCCAGGCGCCTGACCACGTCGGCTCAAGTCCATCCACGCTTCCTTCCATACAT
GCACGGCAGCAAGCCCCTACTCCGGGGCCCCCCAATGCGCCGGTGAGTTTAGCTGCACCCCCACGGTTGTAATATCAGAA
ACATAATTAAAGCGTCCGATGGCTGACATTCCATTCCCCCCCCCTGGACAGGTTGCCTGCTTATATGGCCGTTGCTTGTA
TTGGATATGCTGCTGTTAAATACGGTAACAAGGGGTCAGAAACTGCGGCGACCCAAGACACTCGTCTATCCGAAGATCGC
GTCGCCCTCTTGGATGCGTATGGCGGTCGTGAAAGTCTCGAGGAGCTAGAAATGGCTTCTCGTATTTACAGCATGCAACA
ACAACAAGGCCGTAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62