GenePrediction:GLEAN_3575 Details

Name: GLEAN_3575
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:946073..949084 (+ strand)
Length: 3012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:946073..946263 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_156:946336..946352 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_156:946430..946519 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_156:946798..947156 (+ strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_156:947263..947372 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_156:947777..947859 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_156:947949..949084 (+ strand)
Length: 1136
>GLEAN_3575 class=GenePrediction position=GCSC_156:946073..949084 (+ strand)
ATGACGTTTGATAGCGGATCACAGCAGTCTGTACTGCAACACCACCTGTCACAAGAGTCAGTGGACCAGTCAGCAGCACA
CGGCGGCGATGCCTTTCTCCCTGAAACATACCACTTTCCGACGCATCAGTTGCGAGCTTTGCAGGACTCAAAGAAGAAGC
CTCTGGTACTAGTTGTTTGTGGTTCTTTTAGGTACGCCAATCCTGTGCATTTTTCGATTAGCTGGGATAGATCGAGGCAT
ATACTGACATTCGGCCTCTGCAGTCCCATTACCATTATGCGTAAGAGCGGCTCTTTTTCTTGGGGGATTGACTCATTGTG
AGGTTTTGTGGAACGGCTTCTGACATCGTCTGGATAGATCTCCGCATGTGCGAGATGGCCTTTGACTGGGTGCGCATGGT
GGAGGACGCCTATGAGGTGGTAGGCATGTACTTGTCCCCTGTGTCCGGTAAGCTTTTTGGAATTAATCCCTTGCTCGTAT
ATCGGTGCGAATAGCCCCTTTTGTTAGTATAACGCTTACCATGTTTTTACCAGATGCCTATAAGAAAGCAAACCTCGCGG
AGGCAAAGCATAGGTGGGATACTCTCTCCTTTATTGAGACGGGGTAAAAATTTCTTTGCTGACGGTATATCAGAGTTCGC
ATGTGTGAGTTGGCTGTGGAAGACTCTACAAACTGCGTTATGGTAGACCAGTGGGAAGCCACCCAACCCCGATATGTGCC
TACAGCTCAGGTTCTCGATCATTTCCGCTCGGAAATCAACGAGGTCTTAGGCGGCATCACAGATGCAGAAGGCCAGTCGA
AGAAGGCCGCACGCGTGGCCCTTTTATGTGGTGCCGACCTAATGCAGTCGATGAGTACACCGGGTCTGTGGAGCCCTAAT
GATCTAGACCGCATATTAGGCGAAGGTGGTCTGTATGTTGTAGAGCGGCATGGCACCGATCTGGAGGAGGCTAAGGAAGC
GCTCAGCAGGTGGACAGACAATATCTCTGTGATCCCACAGGGTGTGCCAATAGATTTGTCATCCACCAAAGTGCGCCTGT
TTTTGCACAAACAGATGAGCGTACGCTACTTCGTACCAAATCCAGTGAGTCAAATCAGAGAGCTTTTATATTTCTACTCT
GCAGAACACTAACAAACTTAGGTTATACAGTATATCACTGACAACGGGCTCTATGGAACGAGTAAAACAGAGCTGGCTAA
TGAGGCGCATCCGGATGCTGGAAGAACTGCTGGTGGCGCCAATCTATTCAAACGCGCCTGAGCTGAAGCGATCAAACATC
GCTTTATTCGGCGAGTGGATGTATGAGATACCTGTCGGGATACTCTTCTTTACGAAAGCATACTTGCGGTCGCATATTTT
CAGCGTTAATGGGGGGTTTAGGGGTGAACTGGATACCTTTATGTGTTGCTTTTTGGCTTTGTCTTTTGGAAACTCGTCGT
ATATTCTTGGGCGACAAGCATACATAGCATTGTCGTATCCTCATAACTTACTTATACGAAATTGATGCAATCAAGTCTAT
CCTCCAAGTTGATATGAAAAAGGTATCTACATCGTTATGTGCGATGATACGGGGCGCGTCCGGTCAGCTGCCAGCTAGCC
CATCACGTGACACATGACATTGCTAACAAAATATTCTCACCTCTGAAGAAGACATTCGTATAAATCGAATTTACAACAAA
CTCATTCGCGAATTTTTCTTAAAGCAATACAGAAGACTCTTCTGTAGCCATGGAATCATCTACTCCGCCGAAACAGCCCG
TTTCCATTGTCTGCGTTGGAATGGCAGGTGGGTTGAGCTCCTCAAGACAGACGAGGGTGGTCTGTAGCCAGACCCCTGCC
CAAGTTATAGCATGCCTGACAAGACGATGTACATAGGCTCTGGAAAGACAACATTTATGCAACGCGCGAACGCATATCTA
CACAGCCAGAAGGAACCTCCATATGTGATCAACCTCGATCCTGCCGTTCTGAACGTGCCGTTCGATAGTAATATCGACAT
CCGTGACAGCGTCAACTATAAAGAGGTCATGAAGCAGTATAATCTAGGGCCAAACGGAGGCATTCTGACGGCTTTGAATC
TGTTTTCTACAAAAATCGACCAGATTCTCAATCTGCTTGAGAAGCGCGCATCGCCTGATGCATCCGAGCCAGGAAAGCAG
CCCATAAAGCACATATTGGTCGACACACCCGGACAGATCGAGGCATTTGTGTGGTCTGCCTCTGGAACAATTCTGCTTGA
ATCACTTGCCTCCTCTTTCCCGACAGTCATCGCATACATAATCGACACACCACGTACAGCCAGCACCAGCACTTTTATGA
GCAATATGCTGTATGCGTGCAGCATCCTTTACAAGACGAAACTCCCTATGATATTAGTGTTCAATAAGACAGACGTCAAA
GATGCTGGTTTTGCTAAAGAATGGATGACGGACTACGATTCGTTCCAGGCTGCACTGCGTGAGGAAGAGGACAGAAACGC
ATTTGGTGGCGGGGAGGGTGGCGATAGCATGGGCGGCAGTGGATACATGGGCAGTTTGCTGAACAGCATGAGCATGATGC
TAGAAGAGTTTTATGCCCACCTCAGTGTTGTCGGAGTGAGCTCGATGACGGGGCATGGAGTGGAGGAGTTCTTCCAGGCC
GTTGAGGAGAAGGCAGATGAATTCAAGAGGGACTACCAGCCCGAGCTGGAGCGACGTAGGCGGGAGAGAGATGGCCTGAA
AAAGGCGGCACGCCAGAAGGAGTTGGACAAAATGATGAAGGGACTGAACGTCAAGTCGGATGAGGATGGTTTGCGAAACA
GCAGGACCGAGAACGGCGACGACGACGACGGCGGTGCGGGTAGCCTCGGGAGCGACAATGACGGAGAGGAGTCGGATGAT
GACGATGCTGATCCCGACGAGGAATATGACCGAGAGGGGCTCCAGTCGAGGTATGAAGCAACTTTTTCGGAGCAGAATGA
CCTGACTGCGGACAACGCCAGCTTCGCCAAGTATCTGCATTCGCAAAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62