GenePrediction:GLEAN_3576 Details

Name: GLEAN_3576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:952268..952752 (+ strand)
Length: 485
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:952268..952275 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_156:952320..952418 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_156:952506..952569 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_156:952630..952752 (+ strand)
Length: 123
>GLEAN_3576 class=GenePrediction position=GCSC_156:952268..952752 (+ strand)
ATGGGGAAGTCAGCTTAATCCCGTGGATTCTCATAATTAAACACGTGGTCAGAGCCACTGAGGTGGACATCAAGTCACTG
AAGCTGGCCGAAGTACTGCTGGGGATGTTTGGTGGCATCGAGGACATCTGGCTGACCAAAGCCCACAGAGAGTGAGCGAG
TGCAGGACAGGCAGATGGTAGAGCTCATAACTAACCAGAAATTTAGACAGCAACTCGCTTTTCCACGCCTACGAACAGCT
CGGCCAGCGGCTCCAGGATCCAAGAGGTCAAGGCCACGCCCGACAAGGACTTTATTGAAATTGTTAGAACGGCCCGATAA
TTTGTGGGGGAAGAATTCGGCGGCACGCTCCTTGAGTTCTAGTCACTGCTCGCACACGGCATCATCAAGTGTGGCCTCCT
TCAAGCCCTCATCCAGACCTGGGACGAGGTCTTCATGAGCCACAGGCGCTGCAATTCAGCGGGCGCAAATACCACGAGAC
TTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62