GenePrediction:GLEAN_3587 Details

Name: GLEAN_3587
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1048421..1051239 (+ strand)
Length: 2819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1048421..1048565 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_156:1048656..1048902 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_156:1048959..1049664 (+ strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_156:1049734..1050767 (+ strand)
Length: 1034
Type: CDS
Source: GLEAN
Position: GCSC_156:1050835..1050916 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_156:1050988..1051239 (+ strand)
Length: 252
>GLEAN_3587 class=GenePrediction position=GCSC_156:1048421..1051239 (+ strand)
ATGGACACGTCCCATCCTACCGCAGGCTGGGAGCAAGTCGGCGATAGTTTCTATCGCAAGGTCCAGCTGTATACCGCCGT
GTTTGACCGCGATTTGAACCTAGACAACTATGCCGTCGCTGGAGCTCCTTATTCTGGTGCCATAGGTACGGTCTCGCAGT
GCTTGCTCTGCAATTTGCGCGAAGTCTTCTGACTTTGTTACGTGTACAGCATTATGGCATGATGAAAACAAAAAGTCATT
GCCTATCAAGTACGGAGATCGACGAAGCCGAGCATAGACATCTACAGCTCAGCGGGGAAGCTTATTAGGAGCATCAGCTG
GGATAAAGTGTCTGATGTTAGGGGGCTCGGCTGGTCAGACGACGAAAAGCTTTTGATCGTTACGAAGGACGGCACGGTGA
GGTGTTACATGAACCTCCAGGGTGACTTCACACAGTTCTCTCTTGGTAATGGCGTTGAACACCATAGTGTTGAGTCATGC
AGGTATGCAATTTTCGGGTTCCTGCCACCTGGACGTAAACTAACGGGGACGCTCTCAGGTTCTATGACTTCGGCATGGTC
GCCCTGCTGTCGAATAATGCGTTGATATCCGTCACGTCCTATGAGGAGCCTCGCCCAAAGCTCCTGGCCTCCTGCCCAGA
GGGCAGAATCCATTCCTGGACTCTAATTTCACCAAGCCATACTCTATCGAGGTCTGTCGAGGTTCTTCTGAGTATAGGGC
AGACGATTTACGTCGTCGATGCCATGGACTGTGAGGATCGCTTTCTTGATGTTGGACCGTTTGTGCATATCGCCGTCTCA
CCAAACGGCAAGTATGTGGCTCTCTATACGGGCACAGGCGTTGCACATGTCGTTACGAGCGACTTTCAGACTCGACTGAG
CGAGCATCAGTCCAAGTCCAAGATCCCACCCAAGTATTTGCAGTGGTGCGGGAACGATGCTGTTGTCATTGCCTGGGAGG
ACGAAATACACGTTGTCGGTCCTGGAGGCTCCGTCGCTAGCTTCTTCTATGATGCACGGATTCATGTTGTTCAAGACATA
GATGGCGTGCGAGTGATAACCAACGGTACATGCGACTTCCTACAGAAAGTACCCGAAGTGACCGAAGATGTGTTTAGGTT
CGGCACTGAATCGCCGGCCTCAATACTGCTGGATGCTGTCGAACAGCTGGAGGCACAGTCACCCAAAGCAGATGATAACA
TTCAGCTCATTCGGCCCAACCTGACCGAGGCAGTGGACACATGCGTATGCCTCTTCTCCGAGGAGAGATCCCTTCTCTGA
GCGGCATTTTCTCTAACATTGAGTACTGGACAGGTCAATGCCTCTAGCCAAGAGTTCAATACCCATTGGCAGAAACAGTT
GCTGAAGGCTGCCTCATTCGGTAAATCTGTACTGGATATCTACAACAGCGACGATTTTGTCGAGATGTGTGATACTCTTC
GTGTTTTGAACGCCGTGCGGTTCTACGAGATTGGACTTCCTCTGTCTTATGACCAGTACCAACGCTTAGGGCCTGACGGG
CTTATCAAGCGTCTGCTTAACCGCAACGAGCATCTTCTGGCTCTGCGCATCTCCAGCTACCTCCGCCTGCCGACGGACAA
CATTTACGTCCATTGGGCCTGCGCAAAGGTGCGCGTCGGCTCGGAAGACGACGATACGTTGTGCCAGATTATTGTCGAGA
AGTTGTCCGGGAAACCAGGCATCTCGTTCGAGGAGATAGCGCGAGCTGCATATGACGAGGGACGCGCCCGGTTGGCAACA
GAACTGCTGAATCACGAACCACGGGCAGGCCGACAAGTACCTCTTCTTTTGAGCATGGAAGAAGACGAGCTTGCTCTCGA
CAAAGCTATCGAATCCGGGGATACAGATCTGGTGTATTTTGTCATTGGGCAGATTCGGCGCAAGCTTCCATTGGCAGCCT
TTTTCCGAACAGTGAACAGCCGACCTGTCGCGACCGCCTTGGTCGAGTCGTCGGCGATGCGCGAGGGTGACAACACCTTG
CTCAAGGACATGTACTACCAAGATGACCGTCGGCAAAGCGGTGCGTCTGTCTTCATCCGCGAAGCGTTGCGCCAACCGGA
CAGCCGGACTGCATCAGACAAGCTTGTTTTGGCGGCCAAGGTACTGGCTGATAATCAGAAGGAGAGCGCTTTTGAGCTCG
GGGCGCTCAAAGAGGCGACAACGCTTCTCAGGATGCAAGAGGCGTTTGACCGGGATTTGACAGACAGCTTCACGGGCCTG
AGTGTCAACGACACAATGTTCAAACTTATCCGGCTAGGATACCATGGACGGGCCAAGAAGCTCCAGAGCGAATTCCATGT
GCCGGAGCGAGTGGCGTGGTGGATACGGTAGGCCTTCATGAGCACATGCTGGTGTGTCTGTTTCTTCTTCCTCTCTTTGC
TGACAGCGCTTTAGACTTCGGGCCCTCGTCGCAAAACGAGACTGGGACGAGATCGAAGATATATCCAAGGCCAAGAAGAG
TCCCATTGGCTGGGAGGTACGTGTCTTTCCGTTCGCAGACATGTCCGCATCCAGATAGTCACCCGGTGCTGACCTTTTCC
TCCACAGCCGTTCTTCAACCTTGTTCTGCAAGCAGGCAATACTCGTCTGGCGGCACTATTTGTGCCAAAGTGCGTAAACT
TGGAGTCCGGTGCTGCCATCACGATGTATGAAAAGTGTGGGCTGCGAGTCAAGGCGGCCGAGGAGGCTGTCAAGATCAAA
GACGTAGACGCCTGGACGCGAATATTGGATGCAGCTGGTAAGGGAACGGCCGAGGGACAAAAGATCGAGCAACTGGGCGA
TGCCGCATTCAAAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62