GenePrediction:GLEAN_3589 Details

Name: GLEAN_3589
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1060481..1066060 (+ strand)
Length: 5580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1060481..1060903 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_156:1060971..1064587 (+ strand)
Length: 3617
Type: CDS
Source: GLEAN
Position: GCSC_156:1064647..1064729 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_156:1064841..1065412 (+ strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_156:1065494..1066060 (+ strand)
Length: 567
>GLEAN_3589 class=GenePrediction position=GCSC_156:1060481..1066060 (+ strand)
ATGTGCTCTTTGAAGAGAAAAGAGGCGTCGACTGGAGGCGTGCCTCCAAAGTCGGCAAGATCCGGAAAACCAGACGGTCG
CCCGGCAAAACGGCCGAAGTCAGACAAGAAGGACGACTCAAAGAAAGAGGCCGAAGCTGCAAAACCAGAGCGCAAACTAC
CTGCTTCCGCCGTGACTTCCATTCTGAAGGAGGAGGAACCTCTATTTCCACGTGGAGGCGGCGGCGTTTTGACGCCACTC
GAATACAAGCAGATCCAAGTCCAGGCAAAGAGTGATGCCCTGTTCGAGACCAGCAATGGGACCACAGAAAGAGGAAGTGA
GAAGCGTCTGAAGCCGAATCGCAAGAGCTCCGAGGGCCGCCCCAAACCTAGCACTGCCGCGCCTGCTGAAGAGAGCGTAA
GGATTGAGAGTCTGAACTACAAGGTAGGCTGTCCTGGGATCGCATGGCGCAATCAAATTTGAGACGGGTGATAGCTGACC
TTGGGCAAAGCGCTTGGTGAAAGGCTCATTGGTCCTTGGCCAAATATCGGAAATCACGCCTCTGGAGATCGCCGTCAGTC
TTCCGAATAACCTGGTCGGTCACCTGTCCGTTACGTCCATATCTCAGGCCCTCACCGAGCGGATTGAAGCCGAAGCAGAG
AACGCCAATGACGACGAGGACGCAGCACATGAGGAGGTGGACGTCCAAACGCTGTTTGGACTTGGCCAGTACATTCGCGT
CTCCGTTGTTTCGACCGAGGACGACGATGCCGAGAAGAAGAAAAAGCGGCGCATCGAGCTCTCTACCCGACCAGAACTTG
CCAATGCCGGCCTTACGGACCAGGATGTCGTTCGGAACTCTACTGTCATGGCATCTGTCATCAGCGTCGAAGACCGTGGC
TTTGTGATGGACCTCGGCATCCAAGACTCTGATCTCCGTGGCTTCCTGGCGAAGAAGGAGCTGGACCCGTCCATCCCGGA
AGAGAGACTACAGCCAGGTGCTGTTATTCTGTGTCTCGTCACGGGCAAGGCTACAAATGGAAAGGTGGCACAGCTTTCGG
CCAACAAGACGCAGCTCGGAAGCATCAAGAACGTGGCCTCGGATGCGACTACCATCAACACCTTCCTCCCCGGAACGGCC
GTTGACGTGCTGGTATCAGAGGTGACCGCTCGTGGACTTGCTGGCAAGGTCTTGGGGCATCTCGACGCCACGGCTGATAT
GACACATTCGGGAGCTGGTGGCAGCATTGGCGATCTCGACGAGAAATACAAGGTTGCGTCAAAGATCAAGGCGCGAGTCA
TCTGCACTTTTCCCACGGCCGACAACCCAAAGGTTGCCATATCTCTTCTTCCTCACATACTGTCTCTACAGCAGCAAACA
GCGGGCGGCAAAAATGTCCACGACAAAGCACCAACTCAGGCCCTCCCACTGTCGACCATTGTTGAGAGCTGCGTTGTTCG
CAAAGCTGAGCTGAACGTTGGTTTGTGGGTTGATGTCGGTGTGGAAGGCGTTCCCGGTTTCGTTCACATCTCGCGTGTCA
AAGATGGCAAAGTCGATGCGCTGTACGAGTCATCTGGACCCTTCAAGGTTGGCTCTACCCACCGTGGACGGGTCATCGGC
TACAATGCGGTCGACGGCATCTTCCTGGTCTCTTTTGAGCAGAAAGTTCTTGAGCAGTCCTTTATCCGCATCGAAGATGT
CCCTGTCGGTGACGTTGTCACGGGCCACATCAAGAAGCTCCTCCTTAATCAGAACGGCATCTCTGGGCTGATTGTGGAGA
TTGCGGATGGGATTGCCGGCCTGGTGCCGGAAATCCACTTTTCCGATATCAAGCTCCAGCACCCAGAGAAGAAATTCCGC
GAGGGGATGAAGGTCACTGCGCGGGTCCTATCGATAGACCCAGCCAACCACCAGTTCCGGCTGACGCTCAAGAAGACCCT
TGTCAATTCTGATATCCCCCCAGTCAAGTCGTTTGACGACCTTTCTGTTGGCCAGCAGTGCCTGGGAACCGTTGTCAACG
TCGTCCCCATTGGTGCCTATGTGCAGTTCTACGGCGATCTGCGCGGCTTTTTGCCGGTTGCAGAGATGAGCGAGGCTTTC
ATTCGCGACCCAAAGGAGCACTTTCGACAGGGACAAGCCGTCAATGTCCGCGTCTTGCGCTTCGACCCAGACTTGAACAA
GCTCGTTGTTTCCTGCAAAGACCCATCGGCATTCGGAGTTGACAAGCGACAGGCTCTTCAGGACCTGCAGATCTGCAGTA
TCGTTTCTGCCAAGGCTATCGCAAAGCACGATGACAGTGTTGAAGTTGAGATTGTGGAAAACGGCTTGAAGGCTACCTTG
CCCATCGGCCATCTGTCTGACCGGTCACCGGCGAAGAACCAGGCTGCCCTGAAGCGCATTCACATTGGCCAGGTGCTCCC
CGAGCTTCTTGTCTTGGACAAGCACGAGGGTCGCCGTGTCATCACGGTGTCCCAGAAACCGAGCCTGATAGCCGCCAGCA
AGGAGGGGAAACTTCTGGTCAACATGGAAGATGCCCGGACCGGGTCGCTCGTTACCGGTTTCGTACGGAACATCACGCCG
ACTGCTGCGTTCGTGCAATTTGCTGCGAACATCGTGGCTCTGCTACCGAAGCCTCTCATGCCCCGGACTGCACAGGCTGA
GCCGGACTTTGGTCTGCACAAGTCTCAGACACTCGCACTCAAAATCATCTCTGTGGAAAACGGCAGATTGGTAGCTTCAT
TACCGAGCGATGTGCCAGCAGAAGAAAAGGACACCGGAGAAAAAGCAGGAGCCGGGTCGCGAACACTTTTGAACCCGGTA
GACAGCTCACTTGCAACATTCGACGACCTGCATCTGGGCCAGATTACTAAGGCACGGATCACTTCTGTTAAGAACACTCA
GCTGAATGTCCGGCTGGCGGACAACGTTTCCGGCCGAGTCGATATGTCAGAGATTTTCGACAGTTGGGACGATGTGCCTG
ATGCAAAGAGCCCGCTTCAGAATTTTGAAGAAGGCCAAATTTTGGATGTGCGCATCTTGGGAGTTCACGATGCGAAGCGT
CGCGTATATCTTCCCATCACACAGCAAAAAAGGCGGTCGGTCCTGGAGCTTTCGATAAAGCCGAGCTCACTACAAGGCGG
CAAGACTCCCGACATTCTCAGCATCGACAAGGTTCAGGTCGGATCGTCATGGGTGGCTTTTGTCAACAACCACGGAGCGA
ATTGTCTCTGGCTCAGCCTTACGCCTCATGTCCGAGGTAGGCTGTATGGCATGGAGGCTTCTGACGACATGTCCCTGGTA
AAAGATCTGGAAGCGAATTTCCCCGTGGGAATGGCGATACACGTCCGCGTTGTCCAGGTTGACGTCGAAAAGGGACGCAT
CGACTTGTCTGCTCGGTCACCGGGCGGAGAAGGTGACCTCGCGTGGAGTAGCATCGAAAAGAACCTAGTTCTGCCAGCCA
AGGTCACCAAGGTGAGCGATGGCCAGGTGCTGGTGCAGCTGAGCAAGACCGTGTCTGGACCGCTGCACCTTGTCGACATA
GCCGATGACTTCGACCAGGCAACTACGACTGCCTACTTCAAACACGACATCATCCGCGTCTCTGTCGTTTCTGTCGATGC
TAGCAACAAGAGAATGCGGCTCTCGACTCGGCCGTCGCGCGTTCTCAATTCTTCTTTCCCCGTGGAGGACCGTGAGATTC
TGGACTTTTCGGATGTCAAACCTGGCAGCGTGATCCGCGGTTTCGTGCGCGGTATATCGGACAAGGGTGTGTTCGTCAAC
CTGGGCGGCGACGTGGTCGCCTTTGTGCGTGTAACAGACCTGTCGGACTCCTTCTTGAAGGACTGGAAGGCTCACTTCCG
CATCGACCAGCTCGTAAAGGGCCGGGTCACGGCTGTCAAGGCGGAAGTCAAGCAGATCCAGATGAGCCTGAAAGCGTCTG
CAATCGACGAGAACTACGCGCCGTTGCTGACGCTTGACGACCTCCACGAGGGTCAGATTGTCAGCGGGCGGGTGCGCAAG
GTGGCAGACTTTGGTGCCTTCATAGTCGTTGACAACTCGGCCAATGTTAGCGGCTTGTGCCATCGGACGGAGATGGCTGA
CAAGTCGGTCAGAGACGCGACCAAGCTGTACCGGGGAGGGGGGATGTTGTGAAGGCCAAGATTCTGAGCATCAACCGTGA
GAACAGCCGGGTCAACCTTGGGCTGAAGCCGAAGTATTTCGAGGATGAGAGCGACAGCGACGAGGACGCCATGAGCGTGG
ATGGAGGCGGTGCCCTGGGATCGGACGATGGCGGTGACGACGATGATAGCGACGGTGCTGACGACTCAGACGAGGAGATG
GGCGACGATGACCAGCAGGTTTTGCAGATTCGCGGGACAGACAATGTCGCCGACGACGTGTCCGACAACGGGAAGGACGG
AGCCGATGCAGCAAAAACAGCAAACGGTGGCGGACTCTCCGGAGGCGCCTTTGACTGGACGGGCAATGCACTGGACCAAG
AGAACGGCGACTCGCAGTCCGACCTTGACGAGGAGGATGGAGGTGCCCTGGTCGCCAAGCGTAGCAAGCGAAGCAAGAAG
GCAGCAGCAGCTGCCGATATCGACCGGACAGCACAGCTGGACGTCCGGGGACCGCAGACGGCGAGCGACTATGAGAGGCT
GCTGCTTGGACAGGCAGACATGTCGGCGCTGTGGATCGAATACATGGCATTCCAGGTGCAGGTCAGCGAGCTTGCCAAGG
CCCGCGAGATCGCCGAGCGTGCTATCAAGACGATCAACGTGCGCCAGGAGACAGAGCGGCTGAACGTGTGGATTGCGTAC
TTCAACTTGGAGGTGGAGTATGGTTCAGAGGAGACGGCCGACGCCGTGTTCAAGCGAGCTTGTCAATACAACGACGACCG
TGAGGTGTTTGCACGGGCAGCCAGCATCTATATCCAGTCCGGAAAGCTCAATGTAAGTGTTGTCGATGCGAGAACCGAGA
AGGCTGATAGTGTTTGTGTCTGTTTGCTGACCCGAGGCCGTTCCCACTCACAGAAAGCCGACGAGCTCTTCCAGACGATG
ACCAAGAAGTTTGGTGCACAGTCGCCGCAGATCTGGATCAACTATGCGCACTTCCTGCACCACAGCATGCACGACGTGGA
CCGGGCACGGACGCTGCTCACGCGGGCGGTGCAGACGCTGGGCACGAGCGCTGCGACGATCACGCTGATGTCACGGTTCG
CAGCACTGGAGTTCCGGTCGCCTGTGGGCAACCCGGAGCACGGGCGCACGACGTTTGAGACGCTGCTGGACAAATGGCCG
AAGAAGCACGACATCTGGGACCAGCTGCTGGATCTGGAGACGTCAGTGTATACGGCCGAGAAGGCCAAGGGGGCGGAGGG
CAAGGCCGACCCGGCGGTGGTGCGAGATGTGTTTGAGCGCGGGACCAAGGCCAAAGGTTTGAAGGCACGGAGGGCCAAAT
CCTGGTTTCAGCGATGGGCCAAATGGGAGGAGCAGAACGGCGATGCAAAGAGCCGTGCAAGGGTGACGACCCGGGCCAAG
GAATGGGCGGCGGAGGCAGAGAAGAAAAAGGCCGATGCCGAGGGAGCTGAGAGCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62