GenePrediction:GLEAN_3591 Details

Name: GLEAN_3591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1071767..1073415 (+ strand)
Length: 1649
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1071767..1071775 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_156:1072756..1073415 (+ strand)
Length: 660
>GLEAN_3591 class=GenePrediction position=GCSC_156:1071767..1073415 (+ strand)
ATGGCGCCGGTGTGCGAGATCAGTGCCTTGATCACCCGGCTCTTCAGCTCCAGGGCCAGATCCAGGTTCGACCACGTCTT
GTTGCGGTATTCGATCGTCGGCAGCCGGAAGACAAAGTCGTGCACATCCTCGAGGTTGCGGTCGCCCCGGCCCTTGTAGC
TGAGACACAGCACGACCGACGGCATGCGGACATGGGCAAACGTCATGTAGTTGCTGGCGCGGGCGATCATCTTGGTCAGG
TCGTCCGACGTGTGGTTGTTGCCGTGGCCGCCGAGGACGGTCTGGCGGATGATGTTGGAGCTGGAGCTGGCGTTGGCGTT
GGCCGAGGCCGTGGCCGTGGCCGAGGCGCTGGTGTTGGTGATGTTGGTACTGCCCATCTCCGGCTTGGTGCCTTCCGAAT
TTTTGCGGCGCAGGCCGAAGCGGCTGCTGCTGCCGCTGTTGGCCGTGACAGTGCTGCCATCCATGAGCGAGGAGAGGCCG
GTGGCCGAGCGGTTAATGCCGGTGCCAGTGCGCATTGACTGGGCCGATTGCAGCGACTGGATCGATTGCAGCGACTGCAG
CGACTCGTGCGACGGCCGGCGGGCCAGCGACCGCGTCGTCGAGCCTGTGTTGGGCGTGCGGAAGAAGCGGAACGGGTGGC
TGCCGCTGTCGCCTGAGTGCACGCTCGGCGTCTTGTGCTTGCTGCTGCTGCCATCGCCGAGAATTGTGCTTGGGCTTGCC
GACGGCGACGTCGTCGTCCGCTGGTTCGACGTCAGCGTCGGGTGCAGCCGCATCTCCAGCGAGCCTGCGCGGTCACCATC
CAGTGCTGCCGCCGCCGCCGCTGTCGTCTCGTCGGTCGCAAAGATGGATTCGTCGTCCTCGTTGTCGTCCTCGTCGTCCT
CGACGGTCGGCCCGTCGTTGGCCGTGGCCGTGCCGTCCTTGTTGATGGCGTCGCCGTCGCTGTCCGGGAAGATGTACTCG
AACAGCTTCTTGCCAACCTCGTGCTCCAGCTGGATACGCATGGGAAACAGGGTGACCTCAAAGTGGTCCATGACCGTGAT
GCCGGCAATAGCTTCGAGCATGTACCAGTACACGCTTACCATCGGCTGAGTGTCCATGTCACGTGGCCCGGGGCCGCGAG
CATCAAAGTACGGCGCCACCATCTCGGGATAGGTTGCGTCAGGCAGCAGGTTGAGCCCGAGGATGCGGCCGACCTGGATC
AGGTTGATGTGCGAGCCGTCGGCGTTGTCGGTGCGGTCGTACTCGACGTCCTTGAGCTGCAGCTCGACCAGCGGCTCGTG
GCTGTTGCGCACCAGATGCCACACGATTTCGCGCGCCGAAATGCTCCACTTGAGCAGCGCATTGCTCCCGCTGATGCTGC
TGCTCTCGCTGCCGGCCTCGGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCTCGTTCGCTTCGTTGCGCGCC
TGCGACCGCGTGATCGCCTGCATGATGAAGAACAGCTCGTCCTCGCACGCGGCCAGGTCGCGTTCCAGCAGCAGCCGTTC
CTCCCAGCCGCGTCTGTCCAGGTATTTGGAGTGGATCTGGAAGTGCGTCTTGATGTCCTCGAGCTGCCGCACCCGCTCCT
GCAGCCGGATCACCACCTCGGGTGCGCCACGCAGGTCGCTGAAGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62