GenePrediction:GLEAN_3592 Details

Name: GLEAN_3592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1083226..1085477 (+ strand)
Length: 2252
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1083226..1083229 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_156:1083357..1083413 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_156:1083525..1083566 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_156:1083656..1083736 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_156:1083814..1084095 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_156:1084162..1085477 (+ strand)
Length: 1316
>GLEAN_3592 class=GenePrediction position=GCSC_156:1083226..1085477 (+ strand)
ATGCGTTCGTCCGCCCTCGACTTCCCCTCCCTCCCCCCACCTTTTCCGCCATGGCCGGGCTTTTCTGCCGGCTACCCCTT
TTTGTCCAGCGGTCGTATATCGAGCTCTGATGGCTAACGCGCTGCTTGTAGCTCCGAAGAAGAAGGAAGTGCAGAAGCTC
TCCTATGGAGAGTTCATGACTGATGGCAGTACGTTTGGCACCCCGGTCGTGACCTGATCCCGGCCCTGCATCAGCTGCCG
ACATTTTGTTATTTTTTTTTCTTGGCCGATACGGTGCTAGATACTAACTTGCGTCGCAGCCTTTGGCGGCTCTTGGGCTG
ACGAGGTAGAGGAGACCTACGGTATGTTCCTGCACCCACCGATTTGCCATACGGCTGTTTCCCCTGTCAGGTTTGACGCT
GTGATGTGCATTGTGCTAATTTCCCGCAAGAGTCCGGTACCCAGCCGCTTCCGGCTCCTGATCGCCGGGGTGCCAGCTCG
TACAACAATAACTCTTCTTATGCTGACCGGGGTACGTTTAAGTCTTCCCCGCGCTTCTGCAGGGTCCCCGCTTTTGCCGT
TGTTCTTACTTAGACGTACTGTGTGCAGGCTTCTCGTTCCGCGAGACGGTGCCGCAGCGCATCCCCGACAAGCCGCCTTT
TCTCGCTCATCTGGGCAATCTTGATTACGAGATCATGGACGAGGACATCCGACTGTTTCTTGAAGGCTGCGAAGTCACCA
GCGTCCGTCTCATCGAGGACCGCGAGACCAAGCGCCCCAAGGGCTTTGGCTATGCCGAGTTCGCCAATGTGGACGGCTTG
AAGAAGGCCCTAGCTCTTGACGGCAGCTCGTTCCGGGGCCGTAGCATCAAGGTCAAGATTGCAGACCCGCGTACGTATAT
GGTGGACTGAGGGTGCAGGACTGCCTTTGTCTTTCACTGCTAACCATATGCACCAGCCAAGGACCGTGGCGGCTTTTCTT
CCGGCGAGTCTACCCGTGATCTCAGCGAGTGGACGCGCAAGGGTCCCCTGCCAGATCTCCCGTCTCGCGGCGGCGACCGT
CGTTCGGGCCCTGGCGAGTTTGCCGAACGTCGTCCTCCCCGGGAGGCGCCGACTGACGAGAAGATGCGCGACATGACATG
GGAGCGCAAGGGCCCGCTGTCACCTCTGGCACAGCAGGATCACCAGGAGCGGGAGGGCGGCCGCTCCAGAGCGCCTGAGC
AGTCGGACGGCTTCCGCAGCAACCGGAAACAGTCGCCTGCAGCCTGGGGCGAGGGCCGTGCAGAGGGATCCCGGCCTCCT
CGCCGCGAGTTCTCGGACCGCCCAGAGAAGGTTGTCACTGCTGCTGAGCGAGACATGCAGTGGAGAAGCAACATGCGCCC
CGATGGGCCTATCAAGTCGCCAGTAGCATCGCGCAGCGGCAGCGAGGCTCCGTCATCACCGGCTCCTTCGGCCGCCGTCC
CGGCGACACGGCCCAAGCTGAACCTCGCCAAGCGAACCGTTGCGGAGGCTCCCGAGGTGGGCTCTCCGGGAGCGGCCGGT
GGCGACGCAAAATCGAGCCCATTCGGAGCGGCACGTCCTATCAACACGGCAGCCCGCGAGCGCGAGATCGAGGAGAAGCG
GCAAGCGTCGGTGAAGGAGAAGAAAGAGGCCGAAGAGAAGACCAAGGAGGACCAGCGCAAGGCCAAGGAGGCGGCCGCAC
AGGCTGCTGCCGCGGCCAAGATTGCCGAGGAGGAGGCCAAGGTAGCGGCCAAGGTGGCGGCCGAGGTGGCGGCCGAGGTG
GCGGCCGAGGAGGCTGCTGCTAAGGCGGCGGCCGAAGAGGAGGCAGCCAAGGAAGCAGCCAAAGAAGCAGCCAAGGAGGC
GCCGGTCGAGGAGAAGGCCGAAGAGGCCGCAAAAGAAGAGAGTGCCGAGACGACGGCGCCAAATGGTCAGAAGATCCCGG
TGCGCCCGAAAGAGCAGCGCGAGAATGTACAGAACGTCAAGACGCAGACGCGGGCAGCAGAGAGCGGCAACTGGCGGCAG
CCATCGGCAGAGCACCGCGGCCATCGTGGTGGACCGGGCGGAAACGGACCTCGTCGAGGCGGCGGAGCGCCAAGAGGTGC
GCGACACGAAGGCCCGCGTCCTGTGCGCACAAACGGAGGGTCTGGTGGACCGCCGTCGCAGCCGCCGACACCGAGGATCG
CACACGAAGGAGGCGAGCCCAAGGGACCGGACGAGGAGGGCTGGGAGACGGTCCCGAACAAGGGCCGTCGCAGCCAGAAG
CCACGCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62