GenePrediction:GLEAN_3594 Details

Name: GLEAN_3594
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1125311..1127444 (+ strand)
Length: 2134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1125311..1125581 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_156:1125658..1126985 (+ strand)
Length: 1328
Type: CDS
Source: GLEAN
Position: GCSC_156:1127094..1127444 (+ strand)
Length: 351
>GLEAN_3594 class=GenePrediction position=GCSC_156:1125311..1127444 (+ strand)
ATGGCTGCACTGACACAAGTCTCCGTCATTGAGTCGGAAGAAGCCCTGCTGGACGCTTCAACCGCCCCGACCACGCCGGA
GGGAAGCATGTCGTTCAGTCCGGTCTTGCGGCCGTTCCGTGCTGCCGACACCGTCGAAGATGACACCACCACTACCATTG
GCCCCGGCTCGCGTCTGGCTGGCAACAGTGGCCGCCTTCTGCCCACCACTCTGCCGAGTCCCCAGATTCCAAGTGTCCGG
ACGATCTGCTGTGTCGGTGCCGGTTATGTTGGTAAGAAACGTCTCTTGTACCGTCTCCATCCTGGTCTTCCGCCGTGCTG
ATTCGGTTTCGTTCTCGTCTGCTCCAGGTGGACCCACGGCCGCTGTTCTTGCCTTTCAGAACCCCCAGATCCGCGTTGCC
GTCGTCGACAGAGACCCTGTCCGCATCCGACGATGGAACTCGCGTCATCCACCCATCTACGAGCCAGGCCTCGGCGACAT
TGTCCGCATTGCCCGTGACGGATCTCGCGCGTGCTCCTTTGTCAACGTGCCCCTGCCTGGCGCTGACCCGTCCACAGACA
CGGCCCCGATCAGTGTGCCGCCTCGTGAATCGAATCTGTTCTTCTCGACCGAGGTGTCGCGCTGGATCGGCGAGGCCGAC
GTTGTCCTCATCGCCGTGAACACGCCGACCAAGTCGCGCGGTGCCGGTGCTGGCAGTGCCACGGACATGACAGCCTTTGA
GGCTGTCACCGGCGAGGTGGCCAAGCATGCCCGTCCGGGCGCCATCATCGTCGAGAAGTCGACGGTGCCGTGCCGCACCG
CCCAGCTGGTGCACGAGACCATGGCGGTCCACCGTCCCGGCGTGCATTTCGAGATCCTGTCCAACCCCGAGTTCCTGGCT
GCGGGCACGGCCGTCAACGACCTGCTGTATCCCGACCGCGTGCTGATCGGCTCGCTGCCGACGGCGTCGGGCATGCGCGC
AGCCGAGGCTCTGGCTGCGGTGTATGCGGCTTGGGTGCCGCGCAGCCGCATCCCGGCGACCAACGTGTGGTCGTCGGAGC
TGGCCAAGCTGGTGGCCAACTCGATGCTGGCCCAGCGCATCAGCAGCATCAACAGCATTGCGGCCATCTGCGAGCGGACC
GGTGCCGACGTCGACGAGGTGGCGGCGTCGGTGGGCCAGGACCCGCGCATCGGCAACAAGTTTCTCAAGGCCGGCATCGG
TTTTGGCGGCAGCTGCTTCAAGAAGGACATCCTCAACCTGGTGTACCTGTCCGAGTCGCTCGGGCTGGACGAGGTGGCCG
AATACTGGCGCCAGGTGGTGACGATGAACGACTATGCCCGCGACCGGTTTACGCATCGGGTCGTCAAGTGCCTCAACAAC
ACGCTGACCGGCAAGAAGGCCACCGTGCTGGGCTACGCCTTCAAGAAGAATACGAGCGACACGCGCGAGTCGCCGGCGCT
GGAGATCATCAAGACCCTGCTCGAGGAGGGCCCGCGCGAGATTGCCGTCTTCGACCCGTGCTGCAACCCGGTGGTGATCC
GGGACGAGATCAACTGCCTTCTGGGCGGCGACCGCGTGTTGCTTAGCGAGGGCGGCTCGCTCCAGGTCTACACGGACGCC
TACCAGGCCTGTGCCGACAGCAACTGCATCCTGATCACGACCGACTTTGACGAGTTTGGGGGCAAGCCGTTGCCGGTGGC
AGCAAGTGGCACTGCTGCTGCGTCTGCTGCTTCTGCTGCTTCTGCTGCTTCTGCTGCTTCTGCTGCTTCTGCTGCTTCTG
CTTCTCCGGCACCACCCAAGAAGGGCACTCTGGTCGATCCGCGGCCGTTTGACCGGTCCGAGCCGAGCGAGAACGAGCTG
CTGGCACTGCACAAGTTCCTGGTCGGCAGCACGGCCGATGTCGACCACGATCCGCTGCAGCGCTTCCGACCGGAGCTGCT
ATGTGATCCGTCCTGCCCTGACTGCGCTCTCGAGCGGGACGGCTACAAGCTCAACGAGGAGTACAGGCCCCGGGCGAAGC
TGGATTGGATCAAGATCTCGACGCACATGCAGAAGCCGCGCTGGGTCTTTGACGGCCGCGGCGTGCTGGACGTCAAGCGC
ATGGCCAAGCTGGGGCTCCGGGTCGAGAGTGTCGGACGTCAGGGCCGATCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62