GenePrediction:GLEAN_3595 Details

Name: GLEAN_3595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1128027..1130600 (+ strand)
Length: 2574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1128027..1128141 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_156:1128278..1128373 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_156:1128500..1128710 (+ strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_156:1128789..1129356 (+ strand)
Length: 568
Type: CDS
Source: GLEAN
Position: GCSC_156:1129416..1129454 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_156:1129508..1130486 (+ strand)
Length: 979
Type: CDS
Source: GLEAN
Position: GCSC_156:1130554..1130600 (+ strand)
Length: 47
>GLEAN_3595 class=GenePrediction position=GCSC_156:1128027..1130600 (+ strand)
ATGGCCGAGCTCAGCACCGAGCAGCCGCGTCCGGTGCGGCGCAAGTTTGCGATGCCGCCCGTCAAGCTGGCCTGTCTCTC
GTGGTATGGATCCCGCGACCGTGTTTTCGCTCTGCGTATGCGCCTCTGACACTGCCGTTTTTTCCTTGCAGCCGGGCCTC
TAGGACCCGATGTGATGGCGGCCAGCCGTGTGCGTCGGTATGTGATCGAGACTCATGTCCGAACGGGGGTGCAGCCGCTG
ACTGTCTGCAGTGCATCTCGAAGCAGAACGCCTGCGTCTACCGTCCGAGCAGACGTGGCGGGCCTCGCATCCGCAAGAAG
GTGGCGTCTGTCTCGCCGCCCGGACAGGTTCATGATGTGCAGCTGAGCGAGGCCACCCTGAACTTGCCGCTCCTCCCGCC
GACACGCACGTCTCTCCGGCCACCGTGCTGCTTCTCTTCGTGGGCCCTGACTGTGCTAACATGCCCTCCGCAGCGCTCGA
GATTCACAACTTTGTCGATCCTGGCGCGGCACTCGGCCAGCTGCCCGAATTGCCTCCCGACAGCGACTTCATCTTTGACA
ACCTCTTTCTGAACCCGTTTCCCGACCCGGCCTTTGACGAGACGCCGATGCCGCAGCAGACCTTTACGCCTGTGCCGGAA
GTGTCGGGTCCGCTTGTGCGGACGTACCGCAATAACCACAGCCTGTGAGTCATGCAATTTATTCCTTTTCTGTTTTTCCT
TTTTTACCCTCTTTCCAGGAAAACAAAAGCTTACACACACAGTCTGCAGGCATACTACTGCTGGGTGCACACGTTTGTGC
CGATCTTGCCGGCGCCCGAGATATCTCCGCCGCTGGACGAGCCGGTGCCGATCTCGCAAAACCACCCGGACGGCTTCAGC
AGCGGGCTGGACTTTAGTTCTCCGGTGGCCTTGGCACTGTCGGCCGTGCTGGCCCTGGTGCCCTGCGCAGAGGACACGGA
CCCCAGCTCCTCAGAAGCGGTGCCGTTCCGGCGCAATTGCGCGCAGTTCTTTGCACAGGCAGCCATCGAGAGCATCGAGG
CCGAGTCGGAGATCCCGGGCTCGTCGACGGCACCGGAGAAGACGCTGGAGTCGGAACCGCCGACGGTGGACCGGCTACCG
TTCCATCCACGTGTGCCGGTGGAGCTGGAGAGCATCATTGCGCTGAACTTGCTGAGCGTCTACGAATATGCGCAGCGCGG
AAACCTGAAGAAGATGCGCAGCCGGGCCGGACAGGCGTTGATGGAGGCTATGATGACGTTTAACCTGCACAACCAGACGG
ACGACGACGACTACTACGCTGAGGCCAAGCGGAGAGTGTGGTGGATGACGGTAGGTGGTGCTGCTTGCCTCTGCTTGCCT
CCCGTCCTTCCGGCCGCTGACAGAAACAGTATATGTGTGCGACGCAGACGGCCATTGTGAGCTGCACAGTAAGTGGTGAC
TAATCCATTCACGTGATCTGGTCTGCGGCTGACAGTGGCAGCCTCCTCCGTTGGAGCTTTTTGGGGTCTCGTTCACGACC
AAATACCCGACGCTGGAAGTCGACCCCGAGGCGTGGCCGACGCTGATCGAGACGCAGCAGTCGATGCTGTCGGCGACGCA
GTTCATCGTGGACCTGAGCGAGGCGGTGTCGACACGAGCAGACATGGAACCGATCTACAGGAAGTTGGTGGAGCTGGAGA
ACGGCATGGGTCCGCTGGCCGACCGATGCGACGCCTGGGCGGTCAGCGGACCTTTGGCGCCGATCGTGGACGCGTCGGAG
ACCTGTCTGGTGCGGTCGCTGCGGTCGATGGCCCGCACCAAGGTGAACAGCGCGCGGATCAAAGTGCACCGGTACTGTGC
CTTTGGCGACTACCCCGTCTTCAGTGGCAAGATGTGCGACCTGCAGTCGACGGCCGACATGGCAGATGGACCGGATCTGA
TCCTCCGGGCGCCGTGCATGTGCGGGCTCTCGAGCCACAGCGGCACGTCCAAGACGGGCAGTCCGGACAGCCACCACCAG
CAGCAGCAGCACACGCCGTCATCGGGCGGCACACCGGAGACGATCGACAGCATGGGCAGTTCCAGCTGCACGCGTCACGG
CTACGATGCCCGCAAGAATGCGCCGTACACGAGCCACTTCTCGGCCAAGATCTGCCTGCGGTCGGCGCTCAACATTGCCA
ACGACTACGACAACATGCCGTACCCGAACCCGTCGGGCCAGTTTGGGCAGGACCTGTGCTTCCTGTCGCCGACGTCGCCG
ATTGTGGCCCCGCGCATGCTGCCGTCGTATGTCTGCTGCGCGATGCAGGGCGCCTACGTGTTCCTGTCCATCTACCGCAA
GACCAGCACGATCGTGCCGGGCACGGCCAGCAGCGGCTACCTGGTCAGCATGCTGCTGCAGCTGCAGCAAGGCTTGATGT
CGATCCTGGCGGCCATTGAGAACTACGCGACCGCCTTTGAGGCAATCCGGGCGATGCGAGGTGAGCGAGCGGGAAGAGAG
ATTGGTCCGATCCAGACACAAGACTGACGCTGACATGTCCTCTGCAGACCAGGTTCGAAAGTCGGCCGAGTCTCTGATCA
TGCTGAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62