GenePrediction:GLEAN_3597 Details

Name: GLEAN_3597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1140892..1142018 (+ strand)
Length: 1127
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1140892..1141054 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_156:1141127..1141176 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_156:1141233..1141270 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_156:1141342..1141719 (+ strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_156:1141781..1142018 (+ strand)
Length: 238
>GLEAN_3597 class=GenePrediction position=GCSC_156:1140892..1142018 (+ strand)
ATGCTCGCACGTCATTCTCTCGTTCTTCTTGCGTCGGCGACGACAGCCGTGCTCGCGAAAACTTGCGCATTGCAGTTCGA
CGGCCGTGTGCCATCGACATTCAATCTCACCACTTTCGACACTGCGAATGGTGTATTTAATCCGAACAATGTCTTTGGCA
AAAGTACGTTGTCCCCGCGCGGAAAGAGAGGAGAGAGGTAGACCGTCGCTCACAGCCGCCGTCTCGGCCGAACAGATTTG
ACGCTCAGCCAGCTCCTTCGGCTGCCGGCTCAGAAGGGCTCTATAGTAGGTAGTCTCCAGCTGATCTGCCACCCTCCGCT
GTCCGGTCTGACCTGTCCCAGTTCGACGAGAATACTGTCCCTTTCGAGGTCACCATCAGGTACAGTCCGATCCTGTAGCC
CTGGTAGCCTGCTGTCATTGTTGACTCTTCTCTTCTTTCCTCGGCAACAGTGACGAGTCCATTTTTGCCCCCAGCGCCAG
CAACGTCCAAACAGGCTTTCGCCGCGCCGAGATGCTCCCGGCAAGCAACTCGGGCACCGATCCGTCGACAACGGGCATCA
AGACACTGCATTTCAGTCTCATGAAGGACTCGGAGCGGCCACTCAACCTGTCTCACGAATACCAGCTCGTCTTTTTGGAG
AGCAGCGACTTCAGCACGAACCAGCTGGTGCTGAAAACCGGCACTCTCATCGGCCAAGAGACAGCCAACCCTGACACTTT
ACAGCTGCTAGGCAACGTCAACGTAAATCCGCCTCAGGTGCTCTTTAGCACTCCATTTCTGCCGGACGTGTTTCACAACT
TCGCTGTGACGATGGACTTCAATAATCTGTAAGCCTTCTGAAAATCTCCTAACAGTTCCCCAGAACGAGCACCTTTCTGA
CATCCACAGTACCACACAAGTATTCTTCTCCACCGGCAACTCGTCCCTCAAGGCCGTCACCCAGGCCCTCTCCAACGACA
TCAGCGGCCAAGGCGAGTTCCACTTTGGCATGCTCAAGAAACCCATCGACGGCGGCAGTGATATCGTGCACAATGGAACC
CAGGAGTCTGACATTGATGAGGGAATCATTTATGGTGGAATCTTCGAAGAGGACAGCTCCACGGGCTGCGTGAGCCTGTC
GCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62