GenePrediction:GLEAN_3598 Details

Name: GLEAN_3598
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1144740..1145890 (+ strand)
Length: 1151
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1144740..1144793 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_156:1144872..1144989 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_156:1145049..1145890 (+ strand)
Length: 842
>GLEAN_3598 class=GenePrediction position=GCSC_156:1144740..1145890 (+ strand)
ATGTTCTCCGTGTCCCGCATCCAGCGCCGGGCCTTTTCGGCCACTGCCCGAGACGTAAGGAAACCGTCCGAACGGATCGC
CGTCGGCCCAGCGGCGATCTGCGTGGTGCTCTGTTGCTAACTATCGCGCCAGCTGTCCAAGGTCACCGTCCTCGGTGCTG
CCGGTGGCATTGGCCAGCCGCTGTCTCTGCTGCTGAAGCTCAACCCGCGCGTGACGGAGCTTGCTCTGTACGACATCCGC
GGTGCTCCCGGTACGTTTCCTTCTCTGTGGAAGGCGTCTCGGCGTCATGGCAGCCGGCTGACCGGACAGGTGTCGCTGCG
GACATTGCACACGTCAACACCAAGTCGACGGCCAAGGGCTTTGCGCCGACCGACGAGGCCGGCCTGGCTTCGGCCCTCAA
GGACGCCGAGGTGGTGCTCATCCCGGCCGGCGTGCCTCGGAAGCCGGGCATGTCGCGGGACGACCTGTTCAACACCAACG
CCAGCATCGTGCGCGACCTGGCCAAGGCTGTGGCCGAGTCGGCCCCCAAGGCCAAGGTGCTCGTCATCTCGAACCCAGTC
AACAGCACGGTGCCCATCGTGGCTGAGGTGTTCAAGGCCCGCGGCGTCTACGACCCGAAGCGCCTCTTTGGCGTGACCAC
GCTCGACGTCGTCCGTGCCAGCCGCTTCGTCAGCGAGATCGCCAGCTCCGACCCCAAGGATGAGAAGATCGTCGTCGTCG
GCGGCCACAGCGGCCACACCATCGTGCCGCTCTTCAGCCAGAGCAGCCACCCGGAGCTGTCCGACAACGCCGACCTCGTC
CACCGCGTCCAGTTCGGCGGCGATGAGGTCGTCAAGGCCAAGGATGGTGCCGGCTCTGCCACCCTGTCCATGGCCTTTGC
CGGCGCCCGCTTCGCCGACTCCGTCCTGCGCGCCGCCCAGGGCGAGAAGGGCGTCGTCGAGCCCACCTTTGTCGACAGCC
CGCTCTACAAGGACCAGGGCATCGAATTCTTCTCTTCCCAGGTCGAGCTTGGCCCCGACGGTGTCTCCAAGATCCTGCCT
CTCGGCAAGGTCGACGCCAACGAGGAGAAGCTTCTGGCCGTCGCCTTTGAGGACCTCAAGAAGAACATTGCCAAGGGCGT
CACCTTTGCTGCCTCCAGCCCCGGCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62