GenePrediction:GLEAN_3600 Details

Name: GLEAN_3600
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1154804..1158584 (+ strand)
Length: 3781
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1154804..1154962 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_156:1155024..1155952 (+ strand)
Length: 929
Type: CDS
Source: GLEAN
Position: GCSC_156:1156013..1156073 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_156:1156138..1156180 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_156:1156245..1156677 (+ strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_156:1156746..1157197 (+ strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_156:1157786..1158064 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_156:1158124..1158584 (+ strand)
Length: 461
>GLEAN_3600 class=GenePrediction position=GCSC_156:1154804..1158584 (+ strand)
ATGGCCTCGTTTCGAACCCTGCTGCCTGCGGCTGGCGCACACCGTCCGGAAGACTCTCCGGACGACGGGCCGCCTTCCAT
GCATCCCCATCGGCCGCTCCTCAAGCGCATCCGCAGCGTGCCACAGGCCTGCCAGATGTGCCGGCAGATGAAGGCCAAGG
TGCGTATCTGTGCGGTCCGGCTCTCCCGGTCGCCAAGCTCTCCCCGCTGACATCCGGCAGTGCGATGGTGGCAGGCCTCG
CTGCGGCAACTGCATCGACCGTGACCGGCCGTGTGGCTACGAGGGCGAGGCCGGCCAGTCGCGCCAGGCGGCCATGCGGT
CGAGGCTTGCGGCCTACGAGAACGTCTTTGCATCGTTGCGCCAGGCCTCACAGGCCGACTCCGAGCGGCTGTTGTGCCGT
CTGCGCGTCCTGGACGATCCCGTTGCGATGCTGCGCGAGACCGGCGGCTCGACCACGGTGCCGTCTTCGGCCTCATCTCC
CAGGGTTGCTACGGCTTCGACTCTCGCAGCGGCTGCCGTACTGTCATCTCCTATAGCTGCCTCGGCCACCGGCTCTGTCT
CCGACTCGGGCGACGAGCTGAGCGCCAGTCCTCCCAAGAAACCCGCCCAGATGTCCCCCTCCGGCCTTCACAGCACCATC
CTCGTCGAGCTCGCCATGCCTGGGGCTGCCGTCACGGCCAAGGCGCTCTCCGAGTTCTACAAACACGGCGGAAAGCTGCA
GCACGTCTTCGCCGAAGACGAGGCCGGCCGGCTCTACGCCATGCTCTTCGGCTCCCCTGCACCGGTGTCGACCTCGGACA
ATAACCGGAGCATCGCCACAGCCTGCGTTGCCTCGATCGTTGCTGTCGGCATGCAAACCTCGCCCGACCTGTTCACCCCC
GATCAGGCCCGGACAGCCTACAATCTGGCCAAGCACTACTTTGAGCTCGTCATGGAAGCGGCCCCGTTCACCGCTATCAA
ACTCGCCACCATGCTGGCCATCTTCAACCTCATGGCGCAGAACACGGTAGCACTCATGTGGATAGGCGTCGGCTTGAAGC
TGTGCCGCACACATGGCCTTTTCCATAAGACGCCTATCGATCCGATAATAGCATTGGACGAGTGGGTGAAGCTGCGAAGG
TCCTGGCGAATACTTGTTTGCCTGTCGTGGTAAGAACGCCTGAACCGCTCACACCTGCTGTTTTCGTCCTCGCTAATAGG
ATGACTAAGCTGGCTATCCTTCACCATAGGTTCGATATCCGGACAGGAGGTTGAGTTTGAGAGAGTCAATGTGCGTGCCG
GCTCGATGAGCCCCTTTGTATATGCGGTGCGGTGTATTGCTGACCGGATGACAGCCGTCGGCGATGGAGTTCGAGGCAGT
GCCGAGTATCGAAGAAGGTAAGACCACAAGACCACTCTTCCGACTACACGACCGGACACGATCTGACCAGTTCATCTACA
GCCATCGAGGCGGAGTCTGCCAAGATTGCCGTGCTCACCGTCGAGATCTTGCGGGTGCACTTTGCGTTCAAGGAGATCAC
CGTGCTGTCGTTCGAGTCGGTCCTGCGAGACCTGCAGAGCTGGCACAACAAGCTGCCCTTCCAACTGTACCTGGCGAACC
TGAACGACAGTCTCTTGTCGCCCGAGACGCAGCGCGAGGCCTCGCGTCTCCACCTGATGCACCTGGGCGCCATCGTTCTG
GTGTACCGCCGCATGGCGTCGCAGTTCAGCTGCATAGAAAACACCCAGGCGAGCCGCCAGATCCTCGTCCAGGGCCTCGA
CGGCATACCTGACAGCCTTCTGCGGCAGGGCATCGCAGCAGCACGCACGACGGCCCGCATCCTGTCCCATCTCGTCGACA
GTCAGCGCATTCCGAGACGGTGTTGGGTTGTCATGTGCGTGTCCGCTTCTTTTTCTTCTGTCTTCTGGCACCACACTGCT
GACACCGGCCACGCCTCCACAGAATCCAGGCATACACGTGCTGTATCGTGATTCTCCACGTTGTCGCGCAGCGGCAGCTG
CATCGATGCCACCCCGACACGTGGGAGGGCGATCTGCAGCTGGCCCGCGTGTGCCTCCAGGTGCTCAACTACAGCGGTGC
CGTGGACGACGTGGCGAAGGAGTTCCACGGGAAGCTGCATCCCGTCTTCGTGGATCTGTCCAGGGACCAGTGGTCGCGCG
GCTACGGCATGGCCGGCAGTGAGACAGGCTCGGCCGAGCGCGGCCATGTCGGCTTCGAGAGCGTGTCGTTGCTCCTGACT
GCTCCTCTCACTACAGACCCCGGGCACCTCGGTACATCCCTCGACTTGATGGCCATGTTGGGCCGACCATTCCGCAGCCT
CTGGGCCATGAACGCACTGTCAGATGACGGCCGGCCGGCCAGAAGACCGAACCTAGAACTCCCGCAGCTTTCGGGTATGG
ACTGGTCGAGGGAGCTGCGGTGAGGTGTGGTGGCTTGCGGTTGTTTTTGTTTTTGTCTTTGGATTTTCTCTTCATTTTCT
CATTTTCTCATTCAAATATCCGTTCTTCCTTTCTTTCTTCTTCCCAGCATATAATTCCCAGCTTGCTGCTTTCTCCATAC
ATAAAACGCGATCATGAGCACGCCGTTAGAAACGAGCACAATACAACTAGAATCCAGCGTTTGGCCATGAGAACATCAGA
GGCGCAGCTATGGCAACCTAAAATGCGGGGCCACCCTTATGGCCTGCCCCTCACTAAAAACTAGGGCGGCTCTCCTATTA
GCGGTTGCCTTGAAACACAGAACACAGCCTCAGCCGTCGTTGCTCTCAGGCCAACTCCATCCGGCCCGTTGTCCCAGGTG
TTTGAGCGCGACGACAGCCTGCATCCCCGACCTGCTCCAACCAGAAATCGCCTGCAGACTGTTGTGTTTGTGCTTGGTCG
GCAATTCGCACTATCCGTCTACGCGAAAAAGACCAAAGAGAGAAGACAGAAAAGGGAGCAGAGAAAAAAGAAAAAAGAAA
AAGAAAAGGAGCAATCATCCAGAGTGCCTGTCTCGCCATGTCTGGACGCGAGGAGGTGCACGAGGCAAGCCGGCCACCCC
GACGTTCTCGCCCGTGTGTGTCGGTCGATCCCGTGCTAACCGGCGTCTGCAGGGCGCGTCTGTGCAGGAGCAGCTGGTCG
AGGCCTGCCGGCGCAACAACACCGACCTGCTGTCGGAGGTCTTGGAGGGCCGGTCGGAAGACGAGATCGCCCGGCTGCTG
AACGAGACCACAACGGTGATGGGGAATCACCTGTACCACGAGGCAGCGGCGGCAGGAAACTGTAAGGCTGATCCGGGGAT
CTGTCCGTTGCGTCTGTCCCTAACCTTCTCACGCTCCCAGACGAGATCATCGACATGCTCCTCGACCAGCCCGGCTTCGA
GTGCGATCCTCTGTCCCGCCGCGAAAAGGACACGCCCCTGCACACGGTCGTGCGCTGGTCCAACAAGGAGCCGCCGGCCC
AGCAGCCGTTCGCCCAGGCGCTCGTCGAGATGATGCTCGAGGCTGGGTCTAACCCGCGGCTGAAGAACGGCGCCGGCCTG
ACGGCCACCCAGCTGGTCGACCCGCGCTACCCGGGCCTGCGGCAGGTCATCCAGCGCCACGAGTACGCGCAGCTCAACGC
CGGCGACTTTGTTGAGGCCGACGCGCCCAAAGCCAAGAAGAACAAAACCTCGGCACCTTCGGCACCTTCGGCACCTTCGG
CAGCCAAGAACGACGACGACGACGCCGACTTTAGCGGCAGCGACGAGGGCGAGCGCGCCGAGTGGGAACGCAATCACAAG
GCCCAGCGAGCCCGGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62