GenePrediction:GLEAN_3602 Details

Name: GLEAN_3602
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1176065..1178007 (+ strand)
Length: 1943
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1176065..1177140 (+ strand)
Length: 1076
Type: CDS
Source: GLEAN
Position: GCSC_156:1177215..1177851 (+ strand)
Length: 637
Type: CDS
Source: GLEAN
Position: GCSC_156:1177966..1178007 (+ strand)
Length: 42
>GLEAN_3602 class=GenePrediction position=GCSC_156:1176065..1178007 (+ strand)
ATGTCTTCCTCCATTCCTGAGCTGGTCCTCAACGGCTCTCAGACCAACACTTCTCTGGTGAATGGCACGATCGATACTTC
TGTGCCTTACGCCGTCTTGGCCAACACCTCGAGCATTGCCCTTCCAGACTCAACCGTCTGGTCCTTTCTTGGCCTGGCCT
ATGATCAACGCCACTACCTTCTCGTCCAGGGCCGACTGTTTGCCCTGACGCTTACCATCATCTACATCAGCGCACACAGT
GCGCTGCACAGGCCAAACTCGGCTGCACCTCGCAGAGATGAGGCCGAGGACGATGCCAGCAGTGACAAGACGAAACGCGG
CATACGACGGCGGCGTCGACGGCGTTCGACGACGAGTGATTCCAAGGAGGGAATCCAGGTCCATGAAGCCATACTGATCC
CGTTTGTGGCTGGCGCCGCCCTCGTCGGCATGTACTACCTGTTGCAATACCTGGACGACCCGAAGCTGCTAAGCCGCATC
TTACGGACGTACTCCTCCGTCGTCGGCGTGGCCAGTCTGGGCAAGCTTCTCGGCGACGGCCTGCACAGCATGACGTCCCT
GGTCTTTCCCAACGTGTGGGCTCGCTGGGATCCCACTGGTCAGCAGGAGGTCTTTCGCATCGATCCGACTCGGCGATGCC
AGCTTCGCCAGCAGGTCCGCCAGCAGGAGCCGGCGCCCGGGGGCGAGTCTCCCGATGGCTGGACTGTCGACACGATTCGG
ATCTCGCCCTTCCCAGACCGGTTGGCCTGGCTGGCTCGCACGCCCGCGGCAACTGCACAAGCTTGGACGCTGCGACGCCT
CATGCGCGAGCAGTGGACCGTCCGCGTGGCTATGGCTGGCTTCGGCAATGCCGAGCTGGACGTCACGCTCAGCACGCTTG
TCGGCATCTACGTGTCTGCCGGCCTGGTGGCCGCCTACTGCTTCACCTCGGCGGCCTCGTCGCATACTCTGAACAATCTG
CTTGGCCTGGGCTTCTGCTACGGCAGTCTCATGCTGGTGTCGTGCACCTCGTTCGGCATCGGCTCTATTGTGCTTGTGGG
CCTGTTCGTCTACGATATCGTCATGGTATTCTATACGTAAGTAATACCCCCGCTCCGGCCTGCCTGCTGCTCTTCTGGCA
TTCCGATTTCTGACGCAGACGACCTCATAGGCCGTTTATGGTTACTGTAGCCATGAATGTCGACGCTCCTATCAAGCTTG
TTGCCAGCTCGGGCACCCGCTCGAGCATTTTGGGACTTGGGGACATTGTCGTTCCCGGCATCTTCGTCTGCATGTGTCTA
CGCTACGACCTCCACCGATTCTATGCGCGGCAGATCCAGAGGGTTCCCACCACGCTTGTGACGGAGACGGTGGCCGAGGA
CGGTGCCGCGGTGTCTACAGCCACGGCCACCAAGGACCGCGAAGTGAAGGCGTCCTTCATCGAGCCAAAGGGTCGTTGGG
GCGACAGGCTGTGGACGATGGGCTTGTGGGGCACGCTGTCATCGTCGTTACCGCTGACGCCTGGTCTGCGTGCGGCTGCG
TTTCCCAAGCCGCTCTTTCACACAGCCATGGTGGCCTACTTTGTGGGTCTGTTGGTGGCGGTTAGCATCATGCTGTACAC
GCGACGGGGACAGCCGGCGTTGCTGTATCTGGTGCCAGCCGTTCTCCTGGCGACGTGGGGACGGGCTCTTGCGACCGGCG
AGCTCAAGCAGATGTGGGCGTACACCGAAGACGAATCAGCAGACGTGAAGGAAGTTGTGGTAGAGTTAGGGCCGGATGGG
AAGCCGACGAAGAAGGCTGAAGAGGAAGTGAGTGTAGCGGGCGACAAAAAAGATAAGACAGTGGGAGAAAAGAAGGACGA
CGACGACGACAACGACGACGATGACGACGAGGGCGAGGATGTGCTGTTGTTTTCGCTGCAGACGCCGATCGAGGCGACGT
CTGCAGATCTGGAAGTGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62