GenePrediction:GLEAN_3603 Details

Name: GLEAN_3603
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1178308..1179389 (+ strand)
Length: 1082
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1178308..1178415 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_156:1178472..1179389 (+ strand)
Length: 918
>GLEAN_3603 class=GenePrediction position=GCSC_156:1178308..1179389 (+ strand)
ATGGACGTTCTTTCAGCATCTCCCGACCAGCCTGTGCTGGTGCAATGGCTGCTGGACACACGCAGCTTGTGGCCCGAGGC
CACGCAGACGCAGCAGCTCAAGACAGTGGTACGTAGTCTTCCGGAGTTTGTCCGGGGAGGGATACCGGAGACTTACGCAG
CCAGGCATCGCGGGCACTTGGGGTCCTCCTGACGGACGCAGACCGGACATCGGTGCTGCGATACTTCCACGTGCGCGACG
CCAAGATGGCGCTGGCATCGCTGCTGCTCAAACACCTGATCGTGGCGCGCTGTGCGGGTGTGTGCTGGGAGCGCACGCGG
CTGACGCGGAATGCACACTCGAAGCCGGTCTACCGGGTGCCCGAGGGGGGCACGCAGCCAGTGGCCTTTAACGTCAGCCA
CCAGGCCGGACTGGTGATGCTGGCGGCAGTCTACGGCGGCGAGAAGCGGCACGGCGTCGACGTGGGCGGCTTCTTTGACG
TGGGCGTCGACGTCGTGTCGCCGGGTGAACGACGTGGCCGCGACCACCAAACAATCGATGCCGAGGGCTGGGGATCGTTT
GTGGACATGCACGCAGACGTGTTTGCGACCGGCGAGGCCGAGTGCCTCAAGCACGAAGTGCTGAGCGTAGTGTCGTCGTC
GTCGTTGTCGTCGTCATTGATGCTCAGCCCGAACATGGATCTGGTCGACCTCAAGCTGCGCTGCTTCTACACGCTCTGGT
GTCTGCGCGAGGCGTACGTCAAGATGACGGGCGAGGCACTGCTGGCGCCGTGGCTGGGCGAGCTCGAGTTCCGTCGGTTC
CGGCCACCGCCACCGGTGCAGTCGCCACCGTCGGACACGACGGACTTGCGGCAGGACGCAGCGGCAGCCGTGACGACGCA
TGACATCCGGCTTCGCGGGCACGCCGTCAACGACGTCAACATGTGTCTGCAGGCCCTCGGCGACGACTTCATGGCGTGCA
CGGCCATCCGGACACCAGCAGAGCCGGCGGCAGCAATGGGGCTCGTCATCGGGCCGTTTGAGGTGCTCGACCTGCAGGAC
ATGCTCGACTTTGCCGAGCGGTTTCGCGAAGGAAAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62