GenePrediction:GLEAN_3604 Details

Name: GLEAN_3604
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1180297..1184760 (+ strand)
Length: 4464
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1180297..1180316 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_156:1180386..1182990 (+ strand)
Length: 2605
Type: CDS
Source: GLEAN
Position: GCSC_156:1183147..1184760 (+ strand)
Length: 1614
>GLEAN_3604 class=GenePrediction position=GCSC_156:1180297..1184760 (+ strand)
ATGTCTGACGCCGGTGAAAGGTGAGTGGCCAGCCATTGTTGTCCCTGGCTGGTGCACATGCAGCAGCTAATCAAGTGTCA
CTCCTGCAGCCACCACAAACGATCCAAGAGCACGGCCCTGTCCATTCTCCGACGCAAAGACCGCAGCTTTACGGCCCTCG
ACGAAGAAGCCTCCGAAGATGGATCGACACCGGGCGTGATGCTGTCGACCTCGGCCACCTCACAGACGGCAGGTCCATCA
ATGGCTTACCAGCAGCAGCCACTGCAGCAGCCGATGCCGACGGCCCGGGGCCATCTCTCGCGCAAGTCGACGTCGTACAT
CACGTCATCATCGAAGCTACAGGGCACCACGGCCACTATATTGTCGTCGTCGGCTTTGTCGTCGTCGCCAGTCGCCGCGT
CTCCTTTCTCGGCAGCAGCTGCTGGGGGCAACGGTAGCAGCAACGCGCACGAAAGGGCCCACCTCAACACACTGGAGCAG
TCGGTGCGCAAGTTCCGTATGGTGGAGGCGCTGCGCAACGGCGACACGGCGTCGATCTCCAAGGCGATCCGCGAGACGAG
CGGCGACAGCAATACAAACCCGCGGGCGAGCGTGTCGTCGGTGACGGTCGGGCTCGACGACACGACGATCCTGCACTTGG
CGATCCAGTGCGCCGAGTTTCCGGTGGTGGAGTACGTGTTGTCGGACGGGGCGTCAGCGATAGACATCAACGCCCGGGAC
AAGGACGGCAACACGGCGTTGCACCTGGCAGCAGCACAGGGCCGGACGCATGTGGTGCGGCTACTGCTGGCGCAGAACGG
CATCAACGATGCGGTGATCAACAACATGGGCCGCGTGCCGCTGGACCTGGCACGCAACCCGGAGATCTTCCAGCTGTTGC
AGCTGTCGCGGTCGCTGTTCGCTGAGAGCAAGGTGCAGGAGGTGCAGGACCTGATTGCACGCAACGAGTACAAACGGCTG
GCCGAGGTGCTGGAGGAGCCACGGCTCAAGACGGTGCTGGACATTAACAGCACCGAGTTTGCCATGAACCCGATGACCAT
GCAGGCAGGCGGCACGCTGCTGCACGACGCGGCACGTGCCAAGAACTCGCAGCTGATCCAGGTGCTGCTGCTGCACGGGG
CGGACCCATTCCGGCGCGACCGCAAGGGGCGGCTGCCGCAGGACGTAACCAAGGACGACGTGACGCGGGCGATGTTGAAA
AAGTCGCCGGCGGCCGTGGCAGCCCAGCGCGGCATCCAGGAGAAGGCGGTGCTGGGTGCAGCGGCACAGGGCGGCGGTCT
GGGCTACGGCAGCGGGTCGAGTGCAGCGCTGGGCGTGAATAATGGCGGCAGCGGTGGCAGCCCGTCATCCAGCGGTGGTG
GTGGCGCGGCGAGCGGTGTCGGCAGTCTCGGAGGCGGAATCGGCAGTGGCGGTGGGAGCGGGCACTCGGCGAGCGGCAGC
ACGGCCTCGGGAATGGGCATTGGAGGCATCGGAGCGGGCATGGGAGCGGGTCTGGGCAGCAGTGGCAGCGGCAGCGGCAG
CGGCAGCGGGATGGGCAACAGCGGTGCAGTGATCGCGGCGATGATGATGGATCCGCTGGCAGGACGCGAGGCGCGGGAGA
TGAAGGGATACCTCAAGAAGTGGACCAACTACCGCAAGGGATACCAGCTGCGGTGGTTCGTGCTGGAGGACGGGGTGCTC
AGCTACTACAAGCACCAGGACGACGCAGGGTCGGCGTGCCGGGGCGCGATCAACATGCGGATTGCGCGGCTGCACATGAG
CGTGGACGAGAAGACCAAGTTTGAGATCATAGGCAAGTCGTCGGTCAAGTACACGCTGAAGGCGAATCACGAGGTGGAGG
CAAAGCGCTGGTTCTGGGCGCTCAACAACTCGATCCAGTGGACCAAGGACCAGGCCAAGGAAGAGGAGAAGCGACGGGCG
CTCAGCGCGGAGCGGCTGCGGCAGGCCAAGGCGGAACACTCGCACTCGCAGTCACTGCAGGCGGGCACGGGCAACGGCGG
TGGCGAGGCGCTGAGCGAGAGCGCGAGCGTGGGGGAGAGCGCGATGGGCGGTGGGATCAGTGCGCGGCCGAGCAGCGTGC
AGCTGACGCGGATCACGTCGACGGCAGGACGGTCGACAGCGACGGGCCGACTGCCTGCGACAGGTGGCGGCGCAGGAGCG
AGCACGGTGGGCAGCGTGGACGACGAAGCAGGCGGTGGGATGGGGATGGCCGGAACCGAGATGGACGGCGAGTCTCGCGG
ACCGGGACATCGGGGGGACAACGACGAAGACGAAGACGAAGATGCGGACGGGTCAACGGGCCAAGACCGAGAGGTGCCGA
CGGCAACACGGGACGCATTCACGATCACGGCACAGTCAGCACGGCTGCAGCTGGAGACGATGGCACAGGTGACGCAAGCG
CTGGTGGCAGAAGCCGGACGCAACACGACGCTGACGCTGGCGGACGGACGGATGACGGCAGCGCTGTCAGCATACGACGC
GGCGATCCGGTCGCTGACGGGGCTGGTGGGCGACCTGATGCGAATCTCACGGGACCGGGACGCGTTCTGGCAGTACCGGT
TGGACCGCGAGGTGGAGATGCGGCGGATGTGGGAAGAGAGCATGGCGCAGGTGGCGCGAGAGCAAGAGGCGCTGGAGGCG
CGGGTGGGCGAGGCGGAGGAGAAGAAGCGGACGGCGCGACGTATCCTCAAAGAGGTGATTGGGAGCGGGATGTTGGGGGG
GGTGGCAGAGGAGGGTGAAGCGGAGCGAGAGGGCGAGGGCGAGGGCGAGAGCGAGAGCTCGAAAACGGGTGATGAGAAGG
ACGGAGGAGTGGAGAAGGACGCAGAGGTGCCAACAGAATCGACGGCACAGACACAGACACAGACGGCGACCAGCAGCACA
GCAGCGATCAGCCAGTCACAGCGGCGGGCGGTGCTCAAGCAGCAGGTGGCAGCAGCAGGCCTGTCGGACTCGGAATCGGA
GGACGAGGAATTCTTTGACGCGGTGGACGCAGGCGAAGTGGAGGTGGAGACGAAGCTGCCATCGGAGACGGTGGTCGAGA
CGGGCGGCAAAGAGACGCAGACGGGTTCGGACAGCAAGACAGAACAGACGGACGGGACTTTACAGTCGACAGCGGCATCG
ATTGTGGTGTCGTCGGGAACAGACATCAGCCAGTCCTTTAAGGGGTACGAGAACGGGATCCGGACGCGGCTGAAGATCGA
TGCGGACAACCGGCCGAAGCTGTCGCTCTGGAGCATTCTCAAGTCGATGGTGGGCAAGGACATGACCAAGATGACACTGC
CGGTGACATTCAACGAGCCGACATCGCTGCTATACCGCTGCGGTGAGGACATGGAGTACGCCGACCTCCTGGACTTGGCG
GCCGAGCGAACAGATTCGCTGGAGCGGCTGATGTACGTGGCGGCGTTTGCGGCCAGCGAGTACGCGTCGACGATCGGACG
GGTGGCCAAGCCGTTCAACCCGCTCCTGGGCGAGACGTTTGAGTACGTGCGGCCGGACAAGAACTACCGGTTCTTCATCG
AGCAGGTTAGCCATCACCCGCCAGTGGGTGCAGCCTGGGCTGAGTCGCCGCGGTGGACATACTACGGCGAGTCGGCAGTG
CGATCCAAGTTCTACGGCAAGTCGTTTGACATCAACCCGCTGGGGACGTGGTTTCTGCGGCTGCGGCCGACCCACGGCGG
ACGCGAAGACTTTTACACGTGGAAGAAGGTGACGTCGTCGGTGGTGGGCATCATCACGGGCAATCCGACAGTCGACAACT
ACGGGCCGATGGAAATCCGAAACTGGACGACGGGCGAGGTGGCCCACGTGGAATTTAAGCCGCGCGGCTGGACGGCAGCC
TCGGCCTTTGTGGTGTCGGGCAAGGTGGTGGATGCGAGCGGTCGCGTGCGCATGTCGCTGGGCGGTCGATGGAATTCGCG
GCTGTACGCACGACTGACGCCGGGCTACCAGACGACGGTGGGCGAGAATCCGTCAGCGGCGGCCAGCGGCAGCAGTGGCA
CCAACGGCACCAGCATTGTGTCAGCGCCGGCCGGCAAGGTGTACGACGGCAGCATTGCGGACCAGAGCAAGGCGTACCTG
ATCTGGCAGGCCAACGAACGGCCGACCGGCATTCCGTTCAACCTGACGCCGTTTGTGCTGACGTTCAACCACGTGGACGA
GCAGCTGCGGCCGTATCTGGCACCGACAGACTCGCGGCTGCGGCCGGACCAGCGCGCCATGGAGGAGGGCCGCTACGACT
TTGCGGCCACGGAGAAGAACCGGCTCGAGGAGGGCCAGCGGGCGCGGCGCCAGAAGCGTGAAGCTCGCGGCGAGGAGTTT
GTGCCGGTCTACTTTGAGAAGGCCACGTGCGAGATCACGGGCGAGGCGTACTGGAAGTTCAACGGCCAGTACTGGGAGGA
CCGTGAGCGGGCCGGCCAGGGCGATATCAGTGTGTGGGACAAGATGGAGCCGATATTTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62